TABLE 1

Oligonucleotide primers used in the study

Name of primerExptaSequenceb
Afe frag1 F1Mutant fragment 1 upstream of afeATTTAAATAAAAAGCCATACG
Afe frag1 R1Mutant fragment 1 upstream of afeATAGTTAGTCAAAATTAACCTAATTGCTTGA
Afe frag2 F1Mutant fragment 2 kanamycin cassetteAGGTTAATTTTGACTAACTAGGAGGAATAA
Afe frag2 R1Mutant fragment 2 kanamycin cassetteAAAAATATAACATTATTCCCTCCAGGTACT
Afe frag3 F1Mutant fragment 3 downstream of afeAGGGAATAATGTTATATTTTTAATATATTTT
Afe frag3 R1Mutant fragment 3 downstream of afeACCTGCTGGTGTCATGTATCA
Afe lipoprotein F1Clone AfeA geneGTACCCATGGAGGTCAGCAGACCAAAGAAGA
Afe lipoprotein R1Clone AfeA geneGATCGGATCCCTTTTCAAAACCGCTGGCGA
AfeA 5RT-PCR afeA-afeBGCACTCATTAAGCAAGACCC
AfeB 3RT-PCR afeA-afeBGAGCCAAAGCCCTTGCCA
AfeB 5RT-PCR afeB-afeCGGCAAGGGCTTTGGCTCAAG
AfeC 3RT-PCR afeB-afeCCAGTCACTTGATACATATC
AfeC 5RT-PCR afeC-afeDGATATGTATCAAGTGACTG
AfeD 3RT-PCR afeC-afeDCAATCGTCGCACCTGTCGC
AfeA F1Amplify afeA to assess conservation among strainsATGAAATCAATCAAAACTTT
AfeA R1Amplify afeA to assess conservation among strainsTCACTTTTCAAAACCGCTGG
Afe comp F1Complement afe mutationGATCGGATCCCAATTCATGATTAAGTGGTG
Afe comp R1Complement afe mutationGATCGAGCTCGGTCTTGAACGGTGTTTGTT
Afe PET F1Clone nonlipidated AfeA for thermal shift assaysCACCTGCGGTCAGCAGACCAAAGA
Afe PET 2Clone nonlipidated AfeA for thermal shift assaysTCACTTTTCAAAACCGCTGG
  • a Reverse transcriptase PCR.

  • b Underlined sequences indicate restriction enzyme sites.