TABLE 3

Primers used for validation of RNA-seq data using the Fluidigm Biomark HD high-throughput qPCR system

Associated gene nameSequenceEnsembl transcript identifier
Forward primerReverse primer
ACKR2 GACATCCAGCTCTCAGAGACACACGTGTTGGTGATGCTCAAENSGALT00000008506
AJAP1 GCCTGGAGATTACAAAGCAACCAGACACAAAGGCCACAGGAAENSGALT00000044613
APOA1 CCCTCGCTGTGCTCTTCCGCCTTCACCGTCTCCAGGTAENSGALT00000011524
CASP7 a ATGACCGAAGCTGTGAGGATAGGCAAAACAAGCAGCATCACENSGALT00000014519
CASP9 a TTTCAGGTCCCTGTGCTTCCTTCCGCAGCTCCACATCAAENSGALT00000002085
CCR8 TCTGTGAGGCTTTCGGCAAATCCGTGTTGCGTCTGTTGAAENSGALT00000019499
CD4 AGTGGAACCTGGATGTGTCATTTCCAAGCGTTCCTTCTCAAAENSGALT00000037104
CD40 a AGCCTGGTGATGCTGTGAACTCACAGGGTGTGCAGACAENSGALT00000039105
CMPK2 AGGCTGAACTGGAAGCTAACACTTGGCACGCAGGATTCACENSGALT00000043751
COL2A1_s5 GGTCCTTCCGGCTTCCACAGGAACACCCTGGTCTCCENSGALT00000035835
COL5A2 TGGGAACCACCTGACACAAAGAGCCAAACGTCAGCTTCAAENSGALT00000042826
COL9A2 CCAAGGCTTGCCAGGAGTCACCTTTGGGACCGGTCTTTCCENSGALT00000043674
CREB3L1 ATGCTGAAACCAGCGAGGTAAACAGCTGCCTGCTCACTTAENSGALT00000013673
CRISP3 AGGCGAGACTTCCAATCTTCCGACAGCACAGCTGCAAGACENSGALT00000026918
H6PD a ATGTACCGGGTGGACCACTAAACTGACGGTTCTGATCTCGAAAENSGALT00000003926
HCK ACTGGAAACAGAGCTCAGAGACTCTGCAGGAAGCAGAGAAACAENSGALT00000010538
IL-18 a CGTGGCAGCTTTTGAAGATGTACTGAATGCAACAGGCATCCCENSGALT00000012787
IL1B a TGCTTCGTGCTGGAGTCACGGCATCTGCCCAGTTCCAENSGALT00000000738
IL-6 a AACGTCGAGTCTCTGTGCTAAGTCTGGGATGACCACTTCAENSGALT00000017759
IL-8 a CCCCACTGCAAGAATGTTGAAAGTGCCTTTACGATCAGCTGTACENSGALT00000042745
ITK TGGAACAAGTGCCAGACCAAAAGTCGCTATGGCTTTGGCTAENSGALT00000006130
LAG3 CAGAACCAGAGCAGCAGAAACCAACAGTGACAGCACAGCAAENSGALT00000023369
LITAF a ATCGTGACACGTCTCTGCTAAGCATCAACGCAAAAGGGAAENSGALT00000005095
MAPK8IP3 a GCCAAAGCCAAAATGGAAACCGTCGAGCAACAATCGCTTCAENSGALT00000002721
MHCI-likeY GCCGGAACGCTACAACAAATCCAGGATGTCACAGCCAAAENSGALT00000009998
MMP7 CGGGACAGGCAGACATCATGTGCCACCTCTTCCATCAAENSGALT00000027770
MOV10 CAAGAAGCTGTTGAAGCCCTACAGGAAAGTTGGCCGATACCAENSGALT00000002368
Mx CTGTTGCGATGCTGAACAAATTAGCAAAACGCTTGTTAGCCENSGALT00000025999
MYO7A TGAGGCAGGAATCCTTAGGAACACTGCCACCAGTATTGAACCAENSGALT00000001046
NLRC5 a TTTGCTGCTGCGCTTTCATGTGATGCTTCCACCTGTCAENSGALT00000001908
PRKCB ATGTGGTACAGATGCCAACCAAGCCCCAAACAGAACGGTAAENSGALT00000009676
RHPN2 TGACCGCACATACCGTAACAAAGAGCTGTCCTGAACCAACAENSGALT00000007686
RPL4 a TTCTGCCTTGGCAGCATCAAGGAAGTTCTGGGATCTCCTCAENSGALT00000012495
SDHA a CGTGATCTGGCTCATCTAAAGACTTGCAGTTCAAGGGTCTCCAENSGALT00000021508
SERPINB2 a AAATCACCGTGCCTGTTTCCGTGCTTTAAACCCAGCATGGATAENSGALT00000020982
SLC16A6 TCACAGCAGTGGCATCTACACAGCCAATCTGCTCCTTCAAAENSGALT00000006617
SPON2 TCACACCCAAGGTGGGAAAAACTCTGTGCTCCCTGCAAAENSGALT00000045656
TGFB3 a GGGCCCTGGATACCAACTACGGTCCTGTCGGAAGTCAATGTAENSGALT00000037707
TLR4 a CCTGCTGGCAGGATGCATGTTCTGTCCTGTGCATCTGAAENSGALT00000011333
TRAF6 a TGCCCCAGTACCATGCTTTTAGTGTCGTGCCAGTTCATTCCENSGALT00000012888
TRAT1 CGTAGCACAGCACAGAAACAATTGTCCCCTGCTTCACTCAENSGALT00000036882
WNT4 a AGCAAAGGGGCATCTTCCAATCCACCCGCATGTTGTTCAENSGALT00000007645
Worthington TTCACAGGCACCTACATCACAGGTGTTTTGTGTCCCATGCAENSGALT00000003855
ZNFX1 TGCTGAAGTCTGCTGCTGTAAACATTGGCCGTTCACTGACENSGALT00000007763
  • a The primers were used/analyzed previously (62).