TABLE 1

Oligonucleotide primers and RT-PCR conditions for the analysis of mRNA levels for selected genes

GenBank accession no.GeneaPrimersPCR annealing conditions (temp [°C], time [s])
NM_214009C3SsC3-L (acaaattgacccagcgtagg) and SsC3-R (gcacgtccttgctgtactga)55, 30
NM_214405MUTSsMUT-L (gtttgccaacggtgaaaagt) and SsMUT-R (aatgagcttcaaggcagcat)55, 30
AY373815PRF1Ss-PerfF (gctccaccctgagttcaaga) and Ss-PerfR (agtcctccacctccttggat)57, 30
NM_001001532CCR7Ss-CCR7F (tgtgcttcaagaaggacgtg) and Ss-CCR7R (aagggtcaggaggaagagga)57, 30
NM_182919TRIFHs-TRIFF (caggagcctgaggagatgag) and Hs-TRIFR (ctgggtagttggtgctggtt)55, 30
NM_001243133NLRP3Hs-NLRP3F (cttctctgatgaggcccaag) and Hs-NLRP3R (gcagcaaactggaaaggaag)55, 30
JN391525IFN-βSs-IFNBF (tcagaagctcctgggacagt) and Ss-IFNBR (atctgcccatcaagttccac)55, 30
DQ913893IFN-γSsIFNg-L (ttcagctttgcgtgactttg) and SsIFNg-R (tcctttgaatggcctggtta)55, 30
NM_214055IL-1βSsIL1beta-L (ccaaagagggacatggagaa) and SsIL1beta-R (ttatatcttggcggcctttg)55, 30
NM_001206359GAPDHSs-GAPDHF (gtcggttgtggatctgacct) and Ss-GAPDHR (agcttgacgaagtggtcgtt)55, 30
DQ452569β-ActinSs-BactinF (ggacctgaccgactacctca) and Ss-BactinR (ggcagctcgtagctcttcat)55, 30
AY008846CyclophilinSsCyclophilin-L (agcactggggagaaaggatt) and SsCyclophilin-R (cttggcagtgcaaatgaaaa)55, 30
  • a C3, complement component 3; MUT, methylmalonyl coenzyme A mutase; PRF1, perforin 1; CCR7, chemokine (C-C motif) receptor 7; TRIF, Toll-like receptor adaptor molecule 1; NLRP3, NLR family, pyrin domain containing 3; IFN-β, interferon beta; IFN-γ, interferon gamma; IL-1β, interleukin 1β; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.