TABLE 1

Primers used for PCR screening and sequence analysis

Primer nameSequence (5′ to 3′)Position on Tohama I relative to prn start codonaReference no. or source
PFTGTCTCTGTCACGCATTGTC8 to 2722
PRATGCCGTTGGTGTGTACCGT2,551 to 2,57022
AFGCCAATGTCACGGTCCAA505 to 52222
ARGCAAGGTGATCGACAGGG1,073 to 1,09022
BFAGCTGGGCGGTTCAAGGT1,398 to 1,41522
BRCGGATTCAGGCGCAACTC1,915 to 1,93222
PRN-FCGTACTTTTGCTGCGCCCAT−79 to −6019
PRN-RCCAAGCTCCAGGAAAACCTC2,761 to 2,78019
PRNUP2354GAGAGCCATTTACTGGAGATT−2,353 to −2,333This study
PRN-P-FTGCCAAGACGGTATCTGT−331 to −314This study
PRN-P-RGACTGGTTGTTCCAGTCG102 to 119This study
PRN342RGGTGACGGTGCCCAGAAAGC323 to 342This study
PRNA2FAGGGTGACGGTGTCGGGC982 to 999This study
PRN1627RTATCGACCTTGCCGTCCTT1,627 to 1,645This study
PRNB2FCAGCAGCTGGACAACCGC1,972 to 1,989This study
PRNP2RCTTGCCCTTGACCGCGT2,258 to 2,274This study
PRN2258FCGGTCAAGGGCAAGTACC2,261 to 2,278This study
PRN2357FCCGAGCTGGCGGTATTC2,357 to 2,373This study
  • a prn lies in the region between nt 1,098,091 and 1,100,823 of the Tohama I complete genome (GenBank accession no. NC_002929.2).