Table 1

Primers used in this study

Primer nameGeneSequence (5′ to 3′)Reference or source
LSM12pspACCGGATCCAGCGTCGCTATCTTAGGGGCTGGTT49
SKH63pspA (family 1)TTTCTGGCTCATYAACTGCTTTC49
SKH52pspA (family 2)TGGGGGTGGAGTTTCTTCTTCATCT49
ABW13pspC fragmentCGACGAATAGCTGAAGAGG35
SKH2pspC fragmentCCACATACCGTTTTCTTGTTTCCAGCC35
pspC_gates1pspC full lengthGAAAAAATATAGAAGGAAATAAACThis study
pspC_gates2pspC full lengthCAGTATTAACTAGTTATATTAGGThis study
C5rrgCGCTCTGTGTTTTTCTCTTGTATGG45
C3rrgCATCAATCCGTGGTCGCTTGTTATTTTTA45
plyFply fragmentATTTCTGTAACAGCTACCAACGA48
plyRply fragmentGAATTCCCTGTCTTTTCAAAGTC48