Table 2

PCR primers designed to amplify the fanC gene and to construct the chimeric FanC-STa-E2 genea

PrimerNucleotide sequence (5′–3′)
FanCNheI-F2ATGATGGCTAGCACACTCCTAGCTATTATCTTAGGT
FanCEagI-RTCATCGATACGGCCGCAATGTAA
STa12/FanC91-FGAACTTTGTTGTAATTTTGCCTGTGCTGGATGTGGAAATACTGCTGCTAAAGGATACCAT
STa12/FanC107-RGGCAAAATTACAACAAAGTTCACAGCAGTAAAATGTGTTGTTAGACCAGTCAATACGAGC
BVDV/FanC116-FGCCTTGCCGACCAGTGTGGTATTCGCTAATATTAATACTTCATTCACTACG
BVDV/FanC126-RACTGGTCGGCAAGGCTCTTGTATGCAAAGTCATATGGTATCCTTTAGCAGC
BVDV/FanC154-FCTACTATACAAAGGGGGCTCTGGTGGATATAAAGCTGGCGTATT
BVDV/FanC162-RGCCCCCTTTGTATAGTAGTTGGTCCAGCTGGGCTGAATAGTTAAATGACT
BVD-E2Nde1-F*ATTTCACATATGCACTTGGATTGAAAACCTGAA
BVD-E2BamH1-R*TCTGTAGGATCCAGGCATAGGTCCGAGTTTGGT
  • a PCR primers marked with an asterisk were used to produce the MBP-E2 chimeric gene for the recombinant MBP-E2 protein as coating antigens. Underlined nucleotides indicate restriction sites, and italicized nucleotides are of the inserted STaP12F or E2 epitope.