Table 2

Primers used in this study

PrimerbSequence (5′–3′)aPurpose
ail/BglIIFTCATAGATCTAATGAATAAGACATTACTGGTCTCTCloning of the ail gene into the pET-30a(+) vector
ail/SalIRGGTCGTCGACTTAGAACCGGTAACCCGCGCCAAGCCloning of the ail gene into the pET-30a(+) vector
ompA/NdeIFAGCCATATGAAAAAGACAGCTATCGCATTAGCCloning of the ompA gene into the pET-30a(+) vector
ompA/XhoIRAACCTCGAGAGCCTGTGGCTGAGTCACAACCloning of the ompA gene into the pET-30a(+) vector
caf1/NdeIFCACATATGAAAAAAATCAGTTCCGTTATCGCloning of the caf1 gene into the pET-20b(+) vector
caf1/XhoIRCACTCGAGTTGGTTAGATACGGTTACGGTTACAGCloning of the caf1 gene into the pET-20b(+) vector
  • a Underlining indicates restriction endonuclease site.

  • b F, forward; R, reverse.