Table 2.

Oligonucleotides used

NameNucleotide sequence (5′ → 3′)Target locus and use
4746CGGCATGCCGCAATTGAATTGGGGGPtac-LTB construction
4746CGGCATGCCGCAATTGAATTGGGGGeltB; construction of ΔLTA
4749GGCGTCGACGAAAATGAAGGGGCGAAGTTCastA; construction of EAST1 deletion, amplification of probe for Southern blotting
4750ATGACACGAATGTTGATGGCATCCGGGAAGCConstruction of EAST1 deletion
4751GCCATCAACATTCGTGTCATGGAAGGACTACConstruction of EAST1 deletion
4752GGCGCATGCAAGATTCGGCCAGTTAGCCConstruction of EAST1 deletion, amplification of probe for Southern blotting
4764AATATTACTATGCTCTTCGTAGCGGConstruction of ST deletion mutation, amplification of probe for Southern blotting
4772CCGTCGACTAAAAATCACCACCACTTCConstruction of ΔLTA
4773ATTCATCCTCCTTATATATCATACAAGAAGACAATCCConstruction of ΔLTA
4774GATATATAAGGAGGATGAATTATGAATAAAGTAAAATTTConstruction of ΔLTA
4935TTGTGCAGGTGGATCCGGAGCTTATCGACTGCPtac-LTB promoter construction
47112GGTCAGCCGGAATACGCGTTConstruction of pJCB12-ΔSTIE
47120CATCAGAATCACTATTCATGCTTTCAGGACCACConstruction of pJCB12-ΔSTIE
47121CATGAATAGTGATTCTGATGATGTCTGTAACGConstruction of pJCB12-ΔSTIE
47183CGTCGCATGCGGTGTCTTTATGTGTCTGCConstruction of ompF-LTB, includes SphI site
47184GGCGTCGACGCTATGGACGTTCTGGCTCCConstruction of ompF-LTB, includes SalI site
47192GGCGTCGACCCCATCACCGTCGATGAProphage deletion
47193GGTATCCGTTGCTGTTTCATATCAAAACTCCCProphage deletion
47194ATATGAAACAGCAACGGATACCACCGACGCAGProphage deletion
47195GCCGCATGCATTCAGCCGCCATGTCACProphage deletion
47229GCGGATCCGAGCTCGACATTCAGAAATGAATGACGGConstruction of pJCB-ΔompC::CS1
47230GCTTAGCGCTGCAGGTTATTAACCCTCTGTTATATGCCConstruction of pJCB-ΔompC::CS1
47231AATAACCTGCAGCGCTAAGCCTCGAGTAATCConstruction of pJCB-ΔompC::CS1
47232CGGTCGACGTTAAAGCGCATCAGCGCGGConstruction of pJCB-ΔompC::CS1
47235GATTCCTGTGTGAAATTGTTATCCGATCATAATTCCACACATTATACGAGCCPtac-LTB construction
47236GGATAACAATTTCACACAGGAATCTAGAATGAATAAAGTAAAATTTTATGTTTTPtac-LTB construction
47227GTTACGGAATTGTTGACAATTAATCATCGGCPtac-LTB construction
47228ATTGTCAACAATTCCGTAACAGGATGATCGompF-Ptac-LTB construction
47255GCCACTAGTAATTTCCCCATGCGAGAGTAGGrrnB terminators, includes SpeI site
47256GCGACTAGTGGGATGGCTTGTAGATATGACGrrnB terminators, includes SpeI1 site
47257GGGCAAGCTTATTGCGGATTAGTTTTTTCTTAGCompF-Ptac-LTB construction
47258CTAATCCGCAATAAGCTTGCCCCCCCAGCCTAGompF-Ptac-LTB construction
pFORCCGGTACCATGATTCAATGTACACCAmplification of native LT promoter
pREVACGTAGATCTACTTATATATCATACAAGAmplification of native LT promoter
BforACGTAGATCTTTATGAATAAAGTAAAATTTTATGCloning eltB, includes BglII site
BrevGTACGCTAGCCATGTATCTCATTAGCTGCloning eltB, includes NheI site