Table 3.

Sequences of primers and probes for reaction C

SpecificityOligonucleotide codeaSequence (5′–3′)bSource or reference
cpsA for 25A, 25F, 385694GGGAACGACTATCCTGTTGGAAATCThis study
1046GTCAGCACTTGGTTTCGTTCGAG
3694CTTCTGTTGATTCCGTCCTCGATC
9N, 9L5358TCA ATG GCG ACT TTA TTT GC14
1023GAA CTT TGG GAA TAT AAT CAA AAG
3358AGT CTA TTA TCT CCT GTA GGG TGC
28F, 28A5354CAG AGT TTG GTC GAG GTT CCT A33
1019AGA ACT AAA TAC AGT GCA ATA ATT GG
3354GCT CAA CTT TAT TTC TCT AGA ATA AAC A
10F, 10C5355TAG TTT TGG TTA CGT AGT TGT TGA CT33
1020GAA AAC TTG CCC AAA TCC TT
3355GCA ATA(/G) AAT ACT GTA GCA TAC GAT AGT T
11B, 11C5356TCT GGT GCT AAG GGG ATC AA33
1021TGC ATA AGC TGA TTA TGA GCA TAG
3356CCA ATT ACT CCA TTA TCT ATT GCT AAT
135348GAT GGG AAA ATA CGA TAT GCT C33
1013TGA GCT AAA TGT TGA ATA TTT ATA CCC
3348GAA AAT CGT AAC ATG GAA AAA GTA A
24F, 24A, 24B5363TCA ACA CTT ATG ATG G(A)TG CCT G33
1028CAC AAT CCA AAA CTT AAG TTG TTT C
3363GCA GAA ACA AAA(/G) GTA AGA ATT ATA GAT ATC
12, 44, 465374TGA ATA TGG ACG GTG GAG14
1025GAA GAA GTT CAA CAA TCG CT
3374AGC AAA GAA AGC CGA AAG
19B, 19C5362AGA ATT CGG AGA TTT GTG GTA T33
1027TTC GTA CTG AAA ATT CAT TTC G
3362CAA TCC ACC TCC ATA AAC GA
275364GCA GCC ACC TCT TCT CAT TC33
1029CGC CAA ATT CTA TAC CAA CTA GTA T
3364GGA AGG AAC AAC CCA ACA AT
32F, 32A5365GGT ATG CTT ACA ATG AGA CGC33
1030CCA CTT CCC AGA GGA AAA TA
3365AAT TCG TTC CCG GAT AAG ATG
15F, 15A5347TAT TTC CTT CCT ATG GGA CAA C33
1012AGT CCT TTC CCA AAT ATA GCA CT
3347GCA AGC ATT TTA CCA AGT TCA TAA A
33B, 33D5366TCG TTG GAT GAC AAA ACT CTT AC33
1031GCT CAA TGT GAC AGG GAG AA
3366CCT CCC TGA GCC AAA ATA AC
315344TGA AAA TCC CTT AGT GAC ATC TG
1009GAG CCT TCT CAA TAG TCA TAA AAA A33
3344GCC ATA ATC AAA AAT AAG TTA GAC ATA A
41F, 41A5357TGA CAC TAT TTA TAA TTG CTT TAT CCT T33
1022GGG TGC AAG GTG ATT ATG TAT
3357TAG CGA GAA ACT ATC TGC ATC TTG
295353CCG AAA ATT GTT CAC AGG ATA C33
1018TAA CAA GCA GAA TAA GCA AAA TAG C
3353AGC TTT CTT TTG TAC GAC TCT TTT A
455370TAT GCA GGA AAT ATC CGA GAA GG33
1035CAG CAT ATC TTG CAC GAT AAT GAA
3370CCG TGA AAC AGA AAC GCT ATG
47A5371TAT TTG CCA TAA CGG ACT CTA GAA C33
1036TTT TTA ACA ACC TTG TAT AGA ATA CCT C
3371GCT AAA ATA ATA AAT AGC GAA CTT ACT ACA
33C5375CGA ATC GTC ATA AGG CAA AA33
1038ACC TAC TGT GAC AGG GAA TAG TAA A
3375AAT AGG AGT AAC AAA GAG AAG CCT AA
NCC25433AACACTTGGAACGGAGAATGThis study
1044GACCAGATTACCAAGATCCAGCAAC
3433GCCCTTTGTTATACCTAGATGTTTC
NCC2 and NCC35666ATGCCAAATGGTTCACGGCTGThis study
1045GTGACAGGTATCAAGTACGCAGTG
3666CTGGTCGTCGATTGCTTTCACAC
NCC15658GCAAATCAGCCAGTAACTGTGAThis study
1043CTGTAGAACAGGCAAAGAGCAAGG
3658CAAGATAAGCTTTCTGCACCTCT
  • a Oligonucleotide codes beginning with 1, 3, or 5 designate probes, reverse primers, or forward primers, respectively.

  • b One primer in each primer pair (in boldface) has a biotin label at the 5′ end for detection with avidin. All the probes have an amine group at the 5′ end. Stock primer solutions have 100 μM oligonucleotides in water.