Table 2.

Sequences of primers and probes for reaction B

SpecificityOligonucleotide codeaSequence (5′–3′)bSource or reference
lytA5322CAA CCG TAC AGA ATG AAG CGG33
1006GTC TTT CCG CCA GTG ATA AT
3322TTA TTC GTG CAA TAC TCG TGC G
cpsA (except 25A, 25F, 38)5202GCA GTA CAG CAG TTT GTT GGA CTG ACC20
1039GG TGC TGT CAC ACT CGT CAGThis study
3202GAA TAT TTT CAT TAT CAG TCC CAG TC20
7B, 7C, 405317AAA ACT CAA GTA TCT GTG C(T)CA CCT T33
1001TCC AAA TTT SAG TAA ACC AAC CTA A
3317CAT CTC TAT TCG ACC TTG CGT TA
215352CAA TTC TAC TGA GTC CAT ATT ATG AAA33
1017GAT AGT TTC TCT GTA TCA AAT AGC GA
3352ACC ATC GTA CCT GCA CCA TAA
33F, 33A, 375351TCA ACT AGT CAA GGA TTT GAT GG14
1016TGA TAC CAC AAG TAA CAG AGT CG
3351CGT ATC AGA TTT GCG ATT TC
15B, 15C5346TAA TAA GCG GAT GAT TGT AGC G14
1011GAG CAG GAA TCA GAA CAC AAT C
3346TAT ACT GAT TAA CTT TCC AGA TGG G
16A5361CCG CTC ACG GTA TGG ACT A33
1026GGA GTA AAT GAT GTG TAG TGA AAA CC
3361CCA GCA ATA TAC TCA GGA AAT AAT TC
16F5342TTG TTC TTA CAT TTA GCC GTA GTG33
1007GTT GAA AGA ATA CGA TTC CTA CAA G
3342TCG TCG TTG AAA ACA ATT TCT TAC
185607AAT TGT TCT TTT CCT GTA CTC AGT C14
1039GGA GGA CTT AGT CAA TTT ATC TTG
3607CGA ACC ATT GAA ACT ATC ATC TG
23A5518TTT ACT TTA ATT TAT AGC TTT TTG GCT AA33
1002TGC CTT TTT TAA CGA GGT TG
3318GGT GCA TGA GTT AGG AGA AAG TG
23B5319GGA TCG TTG TTC ATA GCG G33
1003ATA ATT ACT GGT CTG TGA TTT TTC TTT
3319GAT AAT AAA GAA ATT ACT AAC CAT GTC GT
25F, 25A, 385343GAC TAC AAA CTG CGG TAG TAG AAA TG33
1008ATA GGA ACT CTA GGG TTT AGT TTT TTC
3343TGG AAC AAT TCT AAT CGT TAA TAC G
10A, 10B5373TGA GCT ATT TAA GGA CCT GGG14
1024GTT TAG AAA CCT TGC CCA GG
3373GCA AGC GTC ACT TTC TTG A
435369AGA TCA AAT GGT GGT ATT AGG AA33
1034TCG GGT GTA CAA ATC CTA AAC TA
3369GGA ATA GAT CAT TAA CCC TAA TGA AT
365368CAA TTT CCC CTT ATT CTG TAG TTC33
1033AGA TAA ATA CAT CAT TAT TGA CGA ACA
3368TGG AGA TCC CCA AGA GAA AAT A
485372GCA TTT GGA GTT ATT GCC CTA C33
1037CCT ATA AAC ACA CTC AAA ACT AGC A
3372CGA CGG AAT CAA TAT AAA TAA GTG ATA
345608TTA AAA GTA TTA TTG GTA GTG ATT CTT TTGThis study
1040AA TCC ATT GGT ACT CTT CAC AAA
3608TGT AAA GAC ATT CCC TGT AGG C
35A, 35C, 425367GGA GAC TA(/G)T TAA AAC TTT TTT CGT TC33
1032CCT ACT TTA TTA ATG CCT GTT TGA G
3367TTA AGT AAG TCT TCG CAA TCC AG
35F, 47F5521ATA AAA AGA AAG TCT TTG CCA GAG33
1005AAA GTC ACA TC(T)T AAA ATT GAC ACA AC
3321CAA CTT TTG GAA GAT ACT GAA CAT AA
35B5345CTA ATT TGG CTA TGA AGC TAA TCC C33
1010AAG CGT GAA AAA TTT TAA TAA AAG AC
3345TAA CTT AAA TAG GCA TTA ACA AAA TAG GT
6C, 6D5325CATTTTAGTGAAGTTGGCGGTGGAGTTThis study
1042TTTGCAGGTGTAGTAGGCAGG
3645ACTTTACACGACAAACCCATAGAAGC
  • a Oligonucleotide codes beginning with 1, 3, or 5 designate probes, reverse primers, or forward primers, respectively.

  • b One primer in each primer pair (in boldface) has a biotin label at the 5′ end for detection with avidin. All the probes have an amine group at the 5′ end. Stock primer solutions have 100 μM oligonucleotides in water.