Table 2.

Sequences of primers used for qRT-PCR of bovine cytokines

GenePrimerSequence
GAPDHForwardCACCATCTTCCAGGAGCGAG
ReverseCCAGCATCACCCCACTTGAT
β-actinForwardCGCCATGGATGATGATATTGC
ReverseAAGCCGGCCTTGCACAT
U1ForwardCCATGATCACGAAGGTGGTTT
ReverseATGCAGTCGAGTTTCCCACAT
IFN-γForwardTGATTCAAATTCCGGTGGATG
ReverseTTCATTGATGGCTTTGCGC
IL-10ForwardTGCTGGATGACTTTAAGGGTTACC
ReverseTCATTTCCGACAAGGCTTGG
IL-13ForwardAGAACCAGAAGGTGCCGCT
ReverseGGTTGAGGCTCCACACCATG
IL-17AForwardAACATCGTTAACCGGAGCAC
ReverseGGTGGAGCGCTTGTGATAAT
TNF-αForwardTCCATCAACAGCCCTCTGGT
ReverseTGAGGCTTGAGAAGAGGACCTGA