TABLE 1.

Primers used for PCR of VH and VL regions and SOE PCR for construction of diabody

Primer IDSequence (5′-3′)a
Human variable heavy chain forward primers
    HuVH1aGGCGGCGGCGGCTCCGGTGGTGGTCAGGTGCAGCTGGTGCAGTCTGG
    HuVH2aGGCGGCGGCGGCTCCGGTGGTGGTCAGGTCAACTTAAGGGAGTCTGG
    HuVH3aGGCGGCGGCGCCTCCGGTGGTGGTGAGGTGCAGCTGGTGGAGTCTGG
    HuVH4aGGCGGCGGCGGCTCCGGTGGTGGTCAGGTGCAGCTGCAGGAGTCGGG
    HuVH5aGGCGGCGGCGGCTCCGGTGGTGGTGAGGTGCAGCTGTTGCAGTCTGC
    HuVH6aGGCGGCGGCGGCTCCGGTGGTGGTCAGGTACAGCTGCAGCAGTCAGG
Human variable heavy chain reverse primers
    HuJH1-2GGAATTCTGAGGAGACGGTGACCAGGGTGCC
    HuJH3GGAATTCTGAGGAGACGGTGACCATTGTCCC
    HuJH4-5GGAATTCTGAGGAGACGGTGACCAGGGTTCC
    HuJH6GGAATTCTGAGGAGACGGTGACCGTGGTTCC
Human variable light chain forward primers
    HuLAM1GCCATGGCGCAGTCTGTGTTGACGCAGCCGCC
    HuLAM2GCCATGGCGCAGTCTGCCCTGACTCAGCCTGC
    HuLAM3aGCCATGGCGTCCTATGTGCTGACTCAGCCACC
    HuLAM3bGCCATGGCGTCTTCTGAGCTGACTCAGGACCC
    HuLAM4GCCATGGCGCACGTTATACTGACTCAACCGCC
    HuLAM5GCCATGGCGCAGGCTGTGCTCACTCAGCCGTC
    HuLAM6GCCATGGCGAATTTTATGCTGACTCAGCCCCA
Human variable light chain reverse primers
    HuJLAM1GGAGCCGCCGCCGCCAGAACCACCACCACCAGAACCACCACCACCACCTAGGACGGTGACCTTGGTCCC
    HuJLAM2-3GGAGCCGCCGCCGCCAGAACCACCACCACCAGAACCACCACCACCACCTAGGACGGTCAGCTTGGTCCC
    HuJLAM4-5GGAGCCGCCGCCGCCAGAACCACCACCACCAGAACCACCACCACCACCTAAAACGGTGAGCTGGGTCCC
Primers used for construction of diabody
    Variable heavy forward primerGGTGGTGGTGGTTCTGGTGGTGGTCAGGGTCAGCTGGTGCAG
    Variable light chain reverseACCACCACCAGAACCACCACCACCTAGGACGGTCAGCTTGGT-3'
    Variable light chain forward primerATGCATGAATTCTCAGATTGCCATGGCGTC
    Variable heavy chain reverse primerATGCGCGGCCGCCGCATCCTGCAGACGCGT
  • a Restriction sites are underlined.