TABLE 1.

Cytokine-specific primer pair sequences used in PCR

GeneSense primerAntisense primerSizeaReference
IL-1βTCATGGGATGATGATGATAACCTGCTCCCATACTTTAGGAAGACACGGATT502 30
IL-2TGATGGACCTACAGGAGCTCCTGAGGAGTCAAATCCAGAACATGCCGCAG167 30
IL-4CGAAGAACACCACAGAGAGTGAGCTGACTCATTCATGGTGCAGCTTATCG180 30
IL-5GTGAAAGAGACCTTGACACAGCTGCACACCAAGGAACTCTTGCAGGTA290 10
IL-6CTGGTGACAACCACGGCCTTCCCTAATGCTTAGGCATAACGCACTAGGTT600 30
IL-10ACCTGGTAGAAGTGATGCCCCAGGCACTATGCAGTTGATGAAGATGTCAAA237 30
IL-12 p35GCAAGAGACACAGTCCTGGGTGCATCAGCTCATCGATGGC618 30
IFN-γAGCGGCTGACTGAACTCAGATTGTAGGTCACAGTTTTCAGCTGTATAGGG243 30
TNF-αGGCAGGTCTACTTTGGAGTCATTGCACATTCGAGGCTCCAGTGAATTCGG307 30
TGF-βTGGACCGCAACAACGCCATCTATGAGTGGAGCTGAAGCAATAGTTGGTATCCAG502 23
MIP-2GCCAGTGAGCTGCGCTGTCAGTGCGTTAGCCTTGCCTTTGTTCAGTATG221 33
β-ActinTGGAATCCTGTGGCATCCATGAAACTAAAACGCAGCTCAGTAACAGTCCG348 30
  • a Predicted size of the PCR product (base).