TABLE 1.

Sequences of primers used for PCR amplification in this study

Gene and primeraSequence (5′-3′)bLength (bp)
RE
    3R5AGCTGGATCCGAAACCCAGGTGCAGCGTGT30
    v3R-IGC3TGGGGCCGTCTTGGGGGCAGAGCCTCCCGAACCGCCCAG39
scIgG
    3R-scIgG5CTGGGCGGTTCGGGAGGCTCTGCCCCCAAGACGGCCCCA39
    scIgG3AGTCAAGCTTTCATCATTTACCCTGAGT28
RE-scIgG
    3R5AGCTGGATCCGAAACCCAGGTGCAGCGTGT30
    scIgG3AGTCAAGCTTTTTACCCTGAGTCTTGGAGATGGA34
  • a RE represents the tandem-repeat multiple-epitope DNA fragment. scIgG is the swine immunoglobulin heavy-chain constant gene. RE-scIgG is a fusion of the genes for RE and scIgG.

  • b GGATCC, BamHI restriction endonuclease site. AAGCTT, HindIII restriction endonuclease site.