TABLE 1.

Primers used for real-time and end-point PCRs

Primer specificity and procedureForward primerReverse primer
β-Actin
    End-point PCRCGGGCAGGTCATCACCATTGCGCAAGTTAGGTTTTGTCA
    Real-time PCRAACCGTGAGAAGATGACCCAGATGGGACAGCACAGCCTGGAT
CD11aGGAGGCCGGGTGTTTATCTACGGTGGAATAGGAGCACTCGACTT
CD18GGCCCTCAATGGCATCACCCCACCGATGGGTAGTCAAA
IL-1αGCAAGAAAAATTGGTGCACATGGTAAGTAGAGTGCACAGTCAAGGCTATT
IL-1βATTGCCCAGGTTTCTGAAACACTCGTCACTGTAGTAAGCCATCATTT
IL-8TGTAAATTCCAATCGATCTGGAAATAAACCAAGGCGCAGTTCAA
TLR-4TATTTCTTATACCAACATCCGCATTGTTCACAAACACAAGCAAATGCA
TNF-αCCGGTGGTGGGACTCGTATCTGGTTGTCTTCCAGCTTCACA