TABLE 1.

Primer sequences for PCR fragments used in allelic exchange for deletion of genes aroA, lasI, and rhlI

GenePrimer directionPrimer sequence
5′-flanking region of gene3′-flanking region of gene
aroA ForwardGCCGATTGTGCTAACCGCGCGCTCATGTTCATACCTGTAG
ReverseAGCCCTCCACTTCGGTGGTTACGACATGCCGATGGCCAG
lasI ForwardAAGTGGCTATGTCGCCGGGCCTGGACGTATCGCG
ReverseAGTTTTTTATCGAACTCTTCGCGCCTTAAGGAGTCGGACGGG
rhlI ForwardGCTCGGCGATCATGGCGTGTCCGGAAATCCTCATGC
ReverseCGCGGTGCGCCGCAAGGGCGTCATCGGGCGTTCC