TABLE 1.

Primers used to amplify genes encoding proteins used in immunization experiments

GeneDirectionSequence (5′-3′)Amplicon size (bp)
Alpha-toxinForwardCCGCTCGAGTTGGGATGGAAAAATTGAT1,100
ReverseCCGGAATTCTTTATATTATAAGTTGAATTT
HPForwardCCGCTCGAGGAATAAGAGAAAAATAGCAG5,400
ReverseCCGGGTACCACGTTAAATAAATAGAACAT
GPDForwardCCGCTCGAGGGTAAAAGTAGCTATTAACGG1,000
ReverseCCGGGTACCTTAGAAACTAAGCATTTTAAA
FBAForwardCCGCGGATCCATGGCATTAGTTAACGCAAA900
ReverseCCGCCTCGAGAGCTCTGTTTACTGAACCGA
tPFORForwardCCGCCTCGAGCACTTCATTAGAACCAGTTG1,600
ReverseCCGCGGATCCTAGCTAAGTAGTCTTGGTCTCCGCGGATCCTAGCTAAGTAGTCTTGGTCT