TABLE 1.

Oligonucleotide primer sequences

DesignationaNucleotide sequence (5′ to 3′)bDescriptionc
P97c546EcoRI(F)TGATGAATTCGGGGCCTTTAAATCCGTGCTTAATTCCTGGACAGGAAAAATTCAGCCloning and SDM
P97c546(R)GTCTAATTTTGCCCAAGGAGCAAAATTSDM
P97c766(F)AATAATTTTGCTCCTTGGGCAAAATTAGACSDM
P97c766(R)CAACCTCTGTTTTCCAATTTTTACCTTGSDM
P97c1054(F)CAAGGTAAAAATTGGAAAACAGAGGTTGSDM
P97c1054(R)TTGTCGACTTATTTAGATTCTGGTTCCTCCloning and SDM
pAd97cBglII(F)GGAAGATCTGCCACCATGAATTCGGGGCCTTTAAATCCCloning
pAd97cBglII(R)GGAAGATCTTTATTTAGATTCTGGTTCCTCCloning
  • a The numbers indicate the position of the nucleotide A (in TGA codons) replaced by the nucleotide G during site-directed mutagenesis. F, forward primer; R, reverse primer.

  • b The underlined sequences represent EcoRI, SalI, or BglII restrictions sites. GCCACC, Kozak sequence.

  • c SDM, site-directed mutagenesis.