TABLE 2.

Oligonucleotide primers used to amplify MAP2121c

Primer nameSequenceaLocation within MAP2121cb
2121c-F ATCCTCTAGAATGACGTCGGCTCAAAATGAG 1 to 21
2121c-R GCGCAAGCTTCACTTGTACTCATGGAACTG 904 to 924
2121c-N-R GCGCAAGCTTCACTGGATCGTCTGCTCCGGCGT 442 to 462
2121c-CenF ATCCTCTAGACAGACCTATGTGGACTACGAG 232 to 252
2121c-CenR GCGCAAGCTTCACTTCGTCTTGCCGTCCTCCAC 676 to 697
2121c-C-F ATCCTCTAGAACGCTGGCCGGGGCTCCCACG 463 to 483
  • a Underlined nucleotides represent restriction endonuclease cut sites. The XbaI recognition sequence is TCTAGA, and AAGCTT is the HindIII recognition site.

  • b The numbers represent the nucleotide positions within the gene.