TABLE 1.

Primers used for epitope mapping recognized by Res2-6C8 and Res2-1D8

PrimerSequence (5′ to 3′)aTemplate of reaction
R635fCAAGGATCCGAAGACCCTGATATCpGEX-ΔNP631-739
R636fTTGGGATCCGACCCTGATATCGGTCAATCcDNA of EBO-R
R637fTTGAATGGATCCCCTGATATCGGTpGEX-ΔNP631-739
R638fAATGAAGGATCCGATATCGGTCAApGEX-ΔNP631-739
Mu639fTGAAGACCCTGATTAAGGTCAATCAAAGTpGEX-ΔNP631-739
Mu639rACTTTGATTGACCTTAATCAGGGTCTTCApGEX-ΔNP631-739
Mu640fAGACCCTGATATCTAACAATCAAAGTCTApGEX-ΔNP631-739
Mu640rTAGACTTTGATTGTTAGATATCAGGGTCTpGEX-ΔNP631-739
Mu641fCCCTGATATCGGTTAATCAAAGTCTATGCpGEX-ΔNP631-739
Mu641rGCATAGACTTTGATTAACCGATATCAGGGpGEX-ΔNP631-739
Mu642fTGATATCGGTCAATAAAAGTCTATGCAAApGEX-ΔNP631-739
Mu642rTTTGCATAGACTTTTATTGACCGATATCApGEX-ΔNP631-739
Mu643fTATCGGTCAATCATAATCTATGCAAAAATpGEX-ΔNP631-739
Mu643rATTTTTGCATAGATTATGATTGACCGATApGEX-ΔNP631-739
Mu644fCGGTCAATCAAAGTAAATGCAAAAATTAGpGEX-ΔNP631-739
Mu644rCTAATTTTTGCATTTACTTTGATTGACCGpGEX-ΔNP631-739
  • a BamHI restriction site is underlined. Introduced stop codon is in boldface.