TABLE 1.

Sequences of PCR primers and sequence-specific probes for macaque cytokines

CytokinePrimer or probeSequenceCorresponding cDNA sequenceProduct length (bp)
IL-1βaForward primer5′TCACTGCACTGCACACTCCG3′361-380101
Reverse primer5′TGCTCCAGATCCTGTCCCTG3′442-461
Probe5′-FAM-AAGCTTGGTGATGTCTGGTCCATATGAACTGAAAG-TAMRA-3′396-430
IL-8aForward primer5′AGAGTGGACCACACTGTGCC3′217-236138
Reverse primer5′ATGGATTTTGATTCTCAGCCC3′334-354
Probe5′-FAM-TGGGTGCAGAGGGTTGTGGAGAA-TAMRA-3′300-322
IL-6aForward primer5′CACACAGCCAGCCACTGACC3′125-144137
Reverse primer5′TTCTGCCAGTGCCTCTTTGC3′242-261
Probe5′-FAM-CACATTCGGTACATCCTCGACGGCATCT-TAMRA-3′166-191
TNF-αaForward primer5′CAGCCTCTTCTCCTTCCTGC3′127-146143
Reverse primer5′AAGATGATCTGACTGCCTGAGC3′248-269
Probe5′-FAM-CCACGCTCTTCTGTCTGCTGCACTTT-TAMRA-3′162-187
MIP-1αbForward primer5′ACTACTTGGAGACGAGCAGCC3′86-106114
Reverse primer5′CGCTGACATATTTCTGGACCC3′179-199
Probe5′-FAM-CTCCAAGCCCGGTGTCATCTTCCTAA-TAMRA-3′111-136
IL-10aForward primer5′CTTGCTGGAGGACTTTAAGGG3′214-234116
Reverse primer5′GCTCCTTGATGTCTGGGTCG3′310-329
IFN-βaForward primer5′CAACATGACCAACAAGTGTCTCC3′24-46122
Reverse primer5′TTGTAGGAATCCAAGCAAGTTGTAGC3′120-145