Sequences of PCR primers and sequence-specific probes for macaque cytokines

CytokinePrimer or probeSequenceCorresponding cDNA sequenceProduct length (bp)
IL-1βaForward primer5′TCACTGCACTGCACACTCCG3′361-380101
Reverse primer5′TGCTCCAGATCCTGTCCCTG3′442-461
IL-8aForward primer5′AGAGTGGACCACACTGTGCC3′217-236138
Reverse primer5′ATGGATTTTGATTCTCAGCCC3′334-354
IL-6aForward primer5′CACACAGCCAGCCACTGACC3′125-144137
Reverse primer5′TTCTGCCAGTGCCTCTTTGC3′242-261
TNF-αaForward primer5′CAGCCTCTTCTCCTTCCTGC3′127-146143
Reverse primer5′AAGATGATCTGACTGCCTGAGC3′248-269
MIP-1αbForward primer5′ACTACTTGGAGACGAGCAGCC3′86-106114
Reverse primer5′CGCTGACATATTTCTGGACCC3′179-199
IL-10aForward primer5′CTTGCTGGAGGACTTTAAGGG3′214-234116
Reverse primer5′GCTCCTTGATGTCTGGGTCG3′310-329
IFN-βaForward primer5′CAACATGACCAACAAGTGTCTCC3′24-46122
  • a Based on sequences deposited in GenBank. Accession numbers: IL-1β, U19845 ; IL-8, U19849 ; IL-6, AB000554 ; TNF-α, AB000513 ; IL-10, L26029 ; IFN-β, AJ011909 .

  • b Based on an unpublished sequence obtained from Francois Villinger.