Table 1.

Primers designed or selected for amplification of the genes encoding the MAP2 homologs of E. canis and E. chaffeensis

Primers Nucleic acid sequencea (5′ to 3′)
AB249 AAACTCTAATTTTATACA
AB251 AAAATAAGACTAAAAGAAAC
AB282 GTSTTYATAACTRTTGATCC
AB284 GARAAYCTMCCAAAYTCTTC
AB346 CCTGTTAACATTTGAATTCTTG
AB347 GCATTTGAATTCTAGGATC
AB146 CAGGGAAGCTTGCAATTTTTTTGGGATATTC
F13 GTAATTACTCATACACTAA
F17 GAGCACATCATGAAGGCTATC
AB602 GGTACATTATTGCAGAATGG
AB608 TACNNAGNTNNNNCNNNCNNT
AB620 AAACTACTGAACAGGTAATT
AB623 CGTATTTGTTGTGCGCTGG
AB624 CGTATTTGCTGTGCATTTAC
  • a M = A or C; N = A, C, G, or T; R = A or G; S = G or C; Y = C or T.