Table 1.

Primers used in this study

Primer pairRefer-ence(s)SenseSequenceGenBank locus (accession no.)Bases spannedPCR product size (bp)Target gene
TCR-β#1 13 Sense5′GTGTTCCCACCCGAGGTCGCTGTGTTTGAGCC3′C2CDNA16–47124TCR-β
TCR-β #2Antisense5′GTGCTGACCCCACTGTGCACCTCCTTCCCATT 3′139–110
HHV6 A 16, 20, 21 Sense5′TCTCACAGCCCAGGACAATGGATTATATA 3′HHV6AGNM (X83413)43155–43183161ORF U30 (putative capsid myosin)
HHV6 BAntisense5′TGAGATCATTCTCCCGTTCTTCTTGAGGG 3′43315–43295
HHV7 #1 5, 11 Sense5′CAGAAATGATAGACAGATGTTGG 3′HHU43400 (U43400)15678–15700124ORF U10
HHV7#2Antisense5′TAGATTTTTTGAAAAAGATTTAATAAC 3′15801–15775
EBV #1 26 Sense5′AAGGAGGGTGGTTTGGAAAG 3′EBV (V01555)109331–109350296EBNA1
EBV#2Antisense5′ AGACAATGGACTCCCTTAGA3′109628–109609
HCMV#1 13 Sense5′CACGCAACTTTTGGCCGCCACACCTGTCAC 3′HS5PPBC (M15120)2081–2110419Phosphorylated ma-trix protein pp65
HCMV #2Antisense5′CACCACGCAGCGGCCCTTGATGTTT 3′2500–2476