Conservation of the 17-Kilodalton Antigen Gene within the Genus Bartonella

Bacterial strains and preparation of genomic DNA.The sources and designations of the various isolates, representing six species of Bartonella, used in this study are summarized in Table 1. Bacteria were cultivated on heart infusion agar supplemented with 5% defibrinated rabbit blood at 37°C in 5% CO₂. Cultures were incubated for 3 to 5 days until growth was sufficient. B. bacilliformis was cultivated at 28°C without supplemental CO₂ for 7 to 10 days. Colony morphology and staining of bacterial cells by the Gimenez procedure (18) were used to monitor cell growth and purity. DNA was extracted using a procedure previously described (3). Briefly, cell growth was harvested into sterile TE buffer (10 mM Tris [pH 8.0] and 1 mM EDTA). Sodium lauryl sarcosinate was added to a final concentration of 1.0%, and proteinase K was added to a final concentration of 100 μg/ml. After 2 h of incubation at 65°C, the bacterial lysate was repeatedly extracted with an equal volume of buffer-saturated phenol and chloroform. DNA was precipitated by the addition of 1/10 volume of 3 M sodium acetate and 2.5 volumes of cold ethanol. The yield and size of the genomic DNA were assessed by agarose gel electrophoresis.

PCR amplification of the 17-kDa antigen gene homologs.Genomic DNAs from the species listed in Table 1 were used as a template for PCR. Multiple primer pair combinations were constructed from regions surrounding the B. henselae (Houston-1) 17-kDa antigen gene; however, four different primer pair combinations were shown to be optimal and were used to amplify each template as follows.B. clarridgeiae was amplified with primer pair 17KAF (5′ GGAATGAATGATGAGATCGC 3′) and 17KBR (5′ GTTGAGAAGACTATTCATCG-3′). B. quintana and B. henselae, were amplified with primer pair 240 (5′ GCTCTAGACAGGGACAAAGTTCCGTTGTTGC 3′) and 241 (5′-CGGGGTACCGCCATTGTCGTCACAATGACG 3′). B. elizabethae and B. vinsonii subsp. vinsoniiwere amplified with primer pair 17KAF and R2 (5′ TGAAAAGAGGTCCAAGACCT 3′). B. vinsonii subsp.berkhoffii was amplified with primer pair 17KBR (5′ CTGAGCGAGAATTTGAGCTG 3′) and 17KAR (5′ CCAGAAATGCTCTCAAACGG 3′). The positions of these primers are indicated in Fig.1. An additional primer pair derived from highly conserved sequences internal to the 17-kDa antigen gene, consisting of IntF (5′ GAAAAAATATAGCTTAGTCAC 3′) and IntR (5′CTAAAGTCGGACATCAGATT 3′), was also used to confirm the presence of a 17-kDa antigen gene homolog in all of theBartonella species that tested positive. Amplification was performed using the following conditions: 94°C for 2 min, followed by 30 cycles of 94°C for 1 min, 50°C for 2 min, and 70°C for 2 min. The last cycle was followed by incubation at 70°C for 7 min to ensure the adenylation of the 3′ end. PCR amplifications were performed in a DNA thermocycler (MJ Research, Watertown, Mass.) using EasyStart 100 prealiquoted tubes (Molecular BioProducts, Inc., San Diego, Calif.).

• Open in new tab
• Download powerpoint

Fig. 1.

Line diagram showing relative positions of oligonucleotide primers used for PCR amplification of the 17-kDa antigen gene from Bartonella species. The positions of the oligonucleotides are with respect to the sequence of the 17-kDa antigen gene and flanking sequences of B. henselae Houston-1 (accession number U23447 ). Nucleotide positions: 17KBF, 2921 to 2940; 240, 2986 to 3008; 17KAF, 3035 to 3054; 17KAR, 3609 to 3629; 17KBR, 3772 to 3791; 241, 3806 to 3826; R2, 4012 to 4031; Intf, 3158 to 3178; and IntR, 3583 to 3601.

Cloning.Amplicons were cloned directly from the PCR mixture or following gel extraction into pCR2.1-TOPO according to the directions of the manufacturer (Invitrogen, Carlsbad, Calif.). The ligation junction of pCR2.1 is located between two EcoRI cleavage sites. The resulting ligation mixture was transformed into One Shot cells (Invitrogen) and plated on Luria-Bertani (LB) agar containing ampicillin (100 μg/ml) and 80 μl of X-gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) at 20 mg/ml. White colonies were selected and cultured overnight in LB broth with ampicillin. Plasmid DNA was isolated by alkaline lysis and cleaved with EcoRI, and the insert size was confirmed by agarose gel electrophoresis.

DNA sequencing.Plasmid DNA was isolated using the standard protocol from a QIAprep Spin Plasmid Kit (Qiagen Inc., Valencia, Calif.). Clones representing each strain were manually sequenced by a modification (42) of the dideoxy chain termination method of Sanger et al. (36). The resulting denatured double-stranded plasmid was sequenced using a Sequenase Quick-Denature Plasmid Sequencing Kit according to the directions of the manufacturer (Amersham Life Science, Cleveland, Ohio). ³⁵S-dATP-labeled sequencing reaction mixtures were electrophoresed on a 6% acrylamide gel. The dried gel was exposed to X-ray film, and the sequence was recorded. Analysis of DNA sequences was performed using DNAsis version 2.5 for Windows (Hitachi, San Bruno, Calif.).

PCR amplification for ligation into pUC19.Specific oligonucleotide pairs derived from the sequence obtained from each species were synthesized in order to amplify the entire 17-kDa gene with the putative ribosome binding site from each individualBartonella strain. Each oligonucleotide primer derived from the 5′ end of the gene was designed with an XbaI site (-TCTAGA-) near the 5′ end, and the primer derived from the 3′ end of the gene contained a BamHI site (-GGATCC-) near the 5′ end to allow directional cloning. Amplification was achieved through initial denaturation at 94°C for 4 min; 3 cycles of 94°C for 1 min, 42°C for 2 min, and 67°C for 2 min; and 30 cycles of 94°C for 1 min, 50°C for 2 min, and 70°C for 1 min 30 s. Each amplicon was digested with XbaI and BamHI and ligated into pUC 19 cleaved with the same two enzymes so that the 17-kDa antigen gene homologs were immediately downstream of the inducible lacZ α-peptide promoter. The ligation mixtures were transformed into E. coli JM109 as previously described (19), and clones to be used for expression were identified by restriction endonuclease analysis and agarose gel electrophoresis. All recombinants were sequenced again using fluorescent-dye-labeled primers with a Thermosequenase cycle sequencing kit (Amersham) and an automated DNA sequencing and genetic analysis system (Li-Cor Inc., Lincoln, Nebr.).

SDS-PAGE and immunoblotting.Clones were grown to early log phase at 37°C in 5 ml of LB broth containing ampicillin (100 μg/ml) and induced with 1 mM isopropyl thio-β-d-galactopyranoside (IPTG) for an additional 3.5 h. Bacterial cells were harvested by centrifugation and resuspended in one-third of the original culture volume of 1× sample buffer (63 mM Tris [pH 6.8], 10% glycerol, 2% sodium dodecyl sulfate [SDS], 0.0025% bromophenol blue) (Novex, San Diego, Calif.), and β-mercaptoethanol was added to a final concentration of 1%. The samples were boiled for 5 min and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using a 4 to 20% gradient minigel (Novex). MultiMark multicolored standards were used to determine the approximate molecular weight (Novex). The proteins were transferred to nitrocellulose and blocked overnight in Tris-buffered saline (TBS) with 5% skim milk. The resulting membrane filter was incubated with serum diluted 1:200 (human sera) or 1:300 (rabbit serum) in TBS–5% skim milk for 2 h. The membrane filter was washed in TBS with 0.05% Tween 20 four times and exposed to either peroxidase-labeled goat anti-rabbit affinity-purified antibodies (Kirkegaard and Perry, Gaithersburg, Md.; diluted 1:7,000 in TBS with 5% skim milk) or peroxidase-labeled goat anti-human affinity purified antibodies (Kirkegaard and Perry; diluted 1:5,000 in TBS with 5% skim milk). The filter was then washed, and bound antibody was detected with TMB membrane substrate according to directions of the manufacturer (Kirkegaard and Perry).

The human sera used for immunoblots were collected from human immunodeficiency virus (HIV)-infected patients attending the HIV Clinic at the Bay Pines Veterans Affairs Medical Center, Bay Pines, Fla., after informed consent was obtained using a protocol approved by the Institutional Review Board. Serum samples were tested for antibodies toBartonella by IFA as previously described (35). Only sera with IFA titers of 128 or greater were included, and these were tested individually (at a 1:200 dilution) or pooled (and then diluted 1:200). In another experiment, an individual serum sample obtained from a patient diagnosed with CSD with an IFA titer of 2,048 was provided by Patricia Emmanuel, Department of Pediatrics, University of South Florida College of Medicine. In other experiments, polyclonal hyperimmune rabbit serum raised to a fusion protein of the B. henselae (Houston-1) 17-kDa antigen was used at a 1:300 dilution. To produce this serum, a New Zealand White rabbit was immunized with 500 μg of the fusion protein, which has been previously described (5). The rabbit was boosted with an additional 500 μg after 4 weeks, and the animal was bled 1 week later and the serum was collected. The B. henselae (Houston-1) 17-kDa antigen expressed in Escherichia coli was used as a positive control, and E. coli JM109 harboring pUC19 with no insert was used as a negative control.

In vitro transcription-translation.Plasmid template was used in an in vitro transcription-translation reaction designed for circular prokaryotic templates (Promega, Madison, Wis.). Plasmid-encoded proteins were labeled with [³⁵S]methionine and resolved on a 4 to 20% gradient gel (Novex). The resulting gel was exposed to Enhance autoradiography enhancer (NEN Life Science Products, Boston, Mass.), dried, and exposed to X-ray film.

Nucleotide sequence accession numbers.The nucleotide sequence for the 17-kDa antigen gene of B. henselae has been previously published (5) and deposited in the GenBank database under accession number U23447 . The accession numbers for the genes from other strains of Bartonella are as follows:B. henselae (San Antonio-1), AF199503 ; B. quintana (Fuller), AF199006 ; B. quintana (U.Mass),AF199007 ; B. elizabethae, AF195504 ; B. clarridgeiae, AF195506 ; B. vinsonii subsp.vinsonii, AF195505 ; and B. vinsonii subsp.berkhoffii, AF200337 .