Article Figures & Data
Figures
- Fig. 1.
HHV6 primer specificity control. Shown is a nondenaturing polyacrylamide gel stained with a 1:20,000 dilution of Sybr Green I nucleic acid stain (Molecular Probes). The first lane (M) represents a 100-bp DNA ladder (Gibco BRL Life Technologies). Serial twofold dilutions of the various HHV DNAs, ranging from 1,000 to 125 pg (lanes A to D), were amplified with HHV6 PCR primers A and B for a total of 40 cycles. A prominent 161-bp band can be seen in each of the HHV6 A strain U1102 and HHV6 B strain Z29 lanes. In contrast, no bands are apparent in the HHV7, EBV, or HCMV genomic-DNA dilution lanes. Therefore, we conclude that this primer set is specific for HHV6 alone and does not cross-react with its genetically proximate viral relatives.
- Fig. 2.
Detection of HHV6 DNA from human PBMCs. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. The first lane (M) represents a 100-bp DNA ladder (Gibco BRL Life Technologies). Lane 4 is the reagent control, and lanes 3, 21, 38, and 44 are empty. The HHV6 A strain U1102 DNA titration controls are in lanes 2 and 39 to 43 and represent template DNA quantities of 800, 400, 200, 100, 50, and 25 fg, respectively. Amplified products generated from various patient PBMC DNA extracts are in the remaining lanes. HHV6 DNA was detected in patient sample lanes 6, 8, 12, 14 to 18, 23 to 26, and 28 to 36.
- Fig. 3.
Detection of HHV7 DNA from human PBMCs. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. The first lane (M) represents a 100-bp DNA ladder (Gibco BRL Life Technologies). Lane 4 is the mock DNA extract control, and lanes 3, 38, and 44 are empty. The HHV7 strain JI genomic-DNA titration controls are in lanes 2 and 39 to 43 and represent template DNA quantities of 800, 400, 200, 100, 50, and 25 fg, respectively. Amplified products generated from various patient PBMC DNA extracts are in the remaining lanes. A prominent positive 124-bp band can be seen in patient lanes 5 to 8, 10, 11, 13 to 18, 22, 27, 28, 30, 33, 35, and 36. Faint positive bands can be seen in lanes 12, 19, 20, 25, 29, 31, and 32.
- Fig. 4.
Detection of EBV DNA from human PBMCs. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. The first lane (M) represents a 100-bp DNA ladder (Gibco BRL Life Technologies). Lanes 2 and 13 are empty. The EBV strain B95-8 DNA titration controls are in lanes 1 and 14 to 17 and represent template DNA quantities of 800, 400, 200, 100, and 50 fg, respectively. Amplified products generated from various patient PBMC DNA extracts are in the remaining lanes. A prominent positive 296-bp band can be seen in patient lane 6. The remaining patient samples on this gel are negative.
- Fig. 5.
Detection of HCMV DNA from human PBMCs. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. The first lane (M) represents a 100-bp DNA ladder (Gibco BRL Life Technologies). Lanes 2, 6, and 14 are empty. The HCMV DNA titration controls are in lanes 1 and 15 to 18 and represent template DNA quantities of 800, 400, 200, 100, and 50 fg, respectively. Amplified products generated from various patient PBMC DNA extracts are in the remaining lanes. All of the patient DNA extracts represented on this gel are negative and fail to exhibit a band at 419 bp.
- Fig. 6.
HHV6 serology determined by indirect IFA. (A) The indirect IFA results for 51 healthy civilians and 58 civilian CFS patients are graphically represented. The mean serum anti-HHV6 antibody titers ± the standard deviations were 286 ± 62.9 and 295 ± 62.6 for the healthy and CFS groups, respectively. (B) Shown are the same data as were represented in panel A but after stratification of the CFS patient population with regard to the presence (CFS Axis I) or absence (CFS No Axis I) of concurrent psychological symptoms. The CFS axis I diagnosis group (n = 22) had a mean serum anti-HHV6 antibody titer of 155 ± 59.8, compared to the CFS no-axis I diagnosis group (n = 36) mean titer of 381 ± 91.8.
- Fig. 7.
EBV serology determined by indirect IFA. The indirect-IFA results generated from sera of 42 healthy civilians and 47 civilian CFS patients are graphically represented. The error bars indicate 1 standard deviation from the mean serum antibody titer. The CFS patient population shown was stratified by the presence (CFS Axis I; n = 17) or absence (CFS No Axis I; n = 30) of concurrent psychological symptoms. The mean serum anti-EBV VCA (both IgG [A] and IgM [B]), EBNA1 (C), and IE (D) antibody titers are depicted.
Tables
- Table 1.
Primers used in this study
Primer pair Refer-ence(s) Sense Sequence GenBank locus (accession no.) Bases spanned PCR product size (bp) Target gene TCR-β#1 13 Sense 5′GTGTTCCCACCCGAGGTCGCTGTGTTTGAGCC3′ C2CDNA 16–47 124 TCR-β TCR-β #2 Antisense 5′GTGCTGACCCCACTGTGCACCTCCTTCCCATT 3′ 139–110 HHV6 A 16, 20, 21 Sense 5′TCTCACAGCCCAGGACAATGGATTATATA 3′ HHV6AGNM (X83413) 43155–43183 161 ORF U30 (putative capsid myosin) HHV6 B Antisense 5′TGAGATCATTCTCCCGTTCTTCTTGAGGG 3′ 43315–43295 HHV7 #1 5, 11 Sense 5′CAGAAATGATAGACAGATGTTGG 3′ HHU43400 (U43400) 15678–15700 124 ORF U10 HHV7#2 Antisense 5′TAGATTTTTTGAAAAAGATTTAATAAC 3′ 15801–15775 EBV #1 26 Sense 5′AAGGAGGGTGGTTTGGAAAG 3′ EBV (V01555) 109331–109350 296 EBNA1 EBV#2 Antisense 5′ AGACAATGGACTCCCTTAGA3′ 109628–109609 HCMV#1 13 Sense 5′CACGCAACTTTTGGCCGCCACACCTGTCAC 3′ HS5PPBC (M15120) 2081–2110 419 Phosphorylated ma-trix protein pp65 HCMV #2 Antisense 5′CACCACGCAGCGGCCCTTGATGTTT 3′ 2500–2476 - Table 2.
Prevalence of HHV6 and HHV7 in the civilian population: healthy adults versus the stratified CFS subsets
PBMC donors No. with virus/no. tested (%) HHV6a HHV7b Either HHV6 or HHV7 Both HHV6 and HHV7 Healthy adults 19/71 (26.7%) 51/73 (69.9%) 56/73 (76.7%) 14/71 (19.7%) CFS patients 26/74 (35.1%) 58/75 (77.3%) 61/76 (80.3%) 23/73 (31.5%) P valuec 0.29 0.35 0.69 0.13 CFS patients with axis I diagnosis 11/32 (34.4%) 24/31 (77.4%) 27/32 (84.4%) 8/31 (25.8%) CFS patients without axis I diagnosis 15/42 (35.7%) 34/44 (77.3%) 34/44 (77.3%) 15/42 (35.7%) P valuec 0.55 0.65 0.70 0.17 CFS patients reporting acute onset 17/52 (32.7%) 41/53 (77.4%) 42/53 (79.3%) 42/53 (79.3%) CFS patients reporting gradual onset 9/22 (40.9%) 17/22 (77.3%) 19/23 (82.6%) 19/23 (82.6%) P valuec 0.43 0.60 0.89 0.26 ↵a Two CFS and healthy adult control donor samples were omitted from the HHV6 PCR analysis because a definitive determination as to the presence or absence of viral DNA could not be made.
↵b One CFS patient sample was omitted from the HHV7 PCR analysis because a definitive determination as to the presence or absence of viral DNA could not be made.
↵c Determined by Fisher’s exact test.
- Table 3.
Prevalence of HHV7 in the Persian Gulf War veteran population
PBMC donor population No. with HHV7/no. tested (%) Healthy veteran controls 14/32 (43.8%) Veterans with CFS 22/46 (47.8%) P valuea 0.82 Veteran CFS patients with axis I diagnosis 13/33 (39.4%) Veteran CFS patients without axis I diagnosis 9/13 (69.2%) P valuea 0.19 Veteran CFS patients reporting acute onset 1/5 (20.0%) Veteran CFS patients reporting gradual onset 21/41 (51.2%) P valuea 0.48 ↵a Determined by Fisher’s exact test.
