Article Figures & Data
Figures
- FIG 1
(A) Schematic illustration of the afe gene cluster in the M. catarrhalis genome. Arrows indicate direction of transcription, and numbers indicate size of genes in bp. (B) Results of reverse transcriptase PCR (RT-PCR) with RNA extracted from M. catarrhalis O35E to detect afe gene cluster transcript in the regions that span genes as noted at the bottom. a lanes, PCR product from genomic DNA template; b lanes, RT-PCR in the absence of reverse transcriptase; c lanes, RT-PCR product. DNA standards are noted in kilobases. Bands in c lanes indicate that the gene cluster expresses a single transcript.
- FIG 2
Ethidium bromide-stained agarose gel showing amplicons of the afeA gene amplified from genomic DNA of 20 clinical isolates of M. catarrhalis. Lane a, O35E; lanes b to j, sputum isolates from adults experiencing exacerbations of COPD (lane b, 6P29B1; lane c, 10P66B1; lane d, 14P30B1; lane e, 39P33B1; lane f, 47P31B1; lane g, M2; lane h, M3; lane i, M4; lane j, M5); lanes k to t, middle-ear fluid isolates obtained by tympanocentesis from children experiencing acute otitis media (lane k, 2015; lane l, 5193; lane m, 6955; lane n, 7169; lane o, 9483; lane p, 0701057V1L; lane q, 0701064V3L; lane r, 0702076SV4R; lane s, 0701062V1L; lane t, 0701067V3L). Molecular size markers are on the left in kilobases.
- FIG 3
Left, lane a, purified AfeA in Coomassie blue-stained sodium dodecyl (SDS) gel; lane b, purified AfeA in silver-stained SDS gel. Center, immunoblot assay with rabbit antiserum to recombinant purified AfeA (1:106 dilution). Right, immunoblot assay with rabbit antiserum to recombinant purified BCAA SBP1 (branched-chain amino acid substrate binding protein 1). c lanes, whole-cell lysate of wild-type strain O35E; d lanes, whole-cell lysate of afe knockout mutant; e lanes, whole-cell lysate of afe complemented mutant. Molecular weight markers are shown in kilodaltons. Arrows denote AfeA.
- FIG 4
Immunoblot assay of whole-cell lysates of 9 clinical isolates of M. catarrhalis probed with rabbit antiserum to recombinant purified AfeA (1:106 dilution). Strains are sputum isolates in lanes as follows: lane a, 6P29B1; lane b, 10P66B1; lane c, 14P30B1; lane d, 39P33B1; lane e, 47P31B1; lane f, M2; lane g, M3; lane h, M4; lane i, M5. Molecular size markers are shown in kilodaltons on the left.
- FIG 5
Results of whole-cell ELISA with M. catarrhalis strain O35E, afe knockout mutant, and complemented afe mutant used to coat wells and assayed with antisera as noted. x axes are serum dilutions, and y axes are optical density at 450 nm. Results are shown with preimmune and immune antisera. (A) AfeA antiserum with WT and afe knockout mutant. (B) AfeA antiserum with complemented afe mutant. (C) OppA antiserum with WT and afe knockout mutant (positive control; OppA is a surface protein). (D) OppA antiserum with complemented afe mutant. (E) BCAA antiserum with WT and afe knockout mutant (negative control; BCAA is a nonsurface protein). (F) BCAA antiserum with complemented afe mutant. Error bars indicate the standard deviations of the results from three independent experiments.
- FIG 6
Results of flow cytometry with M. catarrhalis wild-type (WT) O35E, afe knockout mutant, and complemented afe mutant. x axes are fluorescence, and y axes are cell counts. (A) WT strain O35E, afe knockout mutant, and complemented afe mutant assayed with AfeA antiserum (1:100) and preimmune serum (1:100). (B) WT strain O35E and afeA knockout mutant assayed with OppA antiserum (1:100) and preimmune serum (1:100) (positive control; OppA is a surface protein). (C) WT strain O35E and afeA knockout mutant assayed with BCAA antiserum (1:100) and preimmune serum (1:100) (negative control; BCAA is a nonsurface protein).
- FIG 7
(A) Immunoblot assays with sera (1:2,000) pooled from mice immunized with PBS (negative control), purified recombinant AfeA (25-μg and 50-μg schedules as noted), and whole cells of M. catarrhalis O35E. a lanes, whole bacterial cell lysate of wild-type strain O35E; b lanes, whole-cell lystate of afe knockout mutant. Arrows denote AfeA. Molecular size markers are shown in kilodaltons on the left. (B) Results of pulmonary clearance 3 h after aerosol challenge with M. catarrhalis O35E following immunization of groups of mice with PBS (negative control), recombinant AfeA, and whole cells of M. catarrhalis strain O35E (positive control). y axis is colony count (in CFU per milliliter) in lung homogenates. Error bars represent the standard deviations (n = 6). Statistically significant overall group differences were observed with a P value of 0.0003. Results of pairwise comparisons with the PBS group (negative control) and associated P values are shown.
- FIG 8
Results of ELISA to purified AfeA with 19 pairs of preexacerbation and postexacerbation serum samples (1:4,000) from adults with COPD followed longitudinally. x axis shows results from individual patients. y axis shows % change in optical density from preexacerbation to postexacerbation values. Dotted line represents the cutoff for a significant change based on assays with control serum pairs (see the text).
Tables
- TABLE 1
Oligonucleotide primers used in the study
Name of primer Expta Sequenceb Afe frag1 F1 Mutant fragment 1 upstream of afeA TTTAAATAAAAAGCCATACG Afe frag1 R1 Mutant fragment 1 upstream of afeA TAGTTAGTCAAAATTAACCTAATTGCTTGA Afe frag2 F1 Mutant fragment 2 kanamycin cassette AGGTTAATTTTGACTAACTAGGAGGAATAA Afe frag2 R1 Mutant fragment 2 kanamycin cassette AAAAATATAACATTATTCCCTCCAGGTACT Afe frag3 F1 Mutant fragment 3 downstream of afeA GGGAATAATGTTATATTTTTAATATATTTT Afe frag3 R1 Mutant fragment 3 downstream of afeA CCTGCTGGTGTCATGTATCA Afe lipoprotein F1 Clone AfeA gene GTACCCATGGAGGTCAGCAGACCAAAGAAGA Afe lipoprotein R1 Clone AfeA gene GATCGGATCCCTTTTCAAAACCGCTGGCGA AfeA 5 RT-PCR afeA-afeB GCACTCATTAAGCAAGACCC AfeB 3 RT-PCR afeA-afeB GAGCCAAAGCCCTTGCCA AfeB 5 RT-PCR afeB-afeC GGCAAGGGCTTTGGCTCAAG AfeC 3 RT-PCR afeB-afeC CAGTCACTTGATACATATC AfeC 5 RT-PCR afeC-afeD GATATGTATCAAGTGACTG AfeD 3 RT-PCR afeC-afeD CAATCGTCGCACCTGTCGC AfeA F1 Amplify afeA to assess conservation among strains ATGAAATCAATCAAAACTTT AfeA R1 Amplify afeA to assess conservation among strains TCACTTTTCAAAACCGCTGG Afe comp F1 Complement afe mutation GATCGGATCCCAATTCATGATTAAGTGGTG Afe comp R1 Complement afe mutation GATCGAGCTCGGTCTTGAACGGTGTTTGTT Afe PET F1 Clone nonlipidated AfeA for thermal shift assays CACCTGCGGTCAGCAGACCAAAGA Afe PET 2 Clone nonlipidated AfeA for thermal shift assays TCACTTTTCAAAACCGCTGG - TABLE 2
Melting temperatures and results of thermal shift assays with purified nonlipidated recombinant AfeA
Sample Cation Tm (°C)a ΔTm (°C)b Nonlipidated AfeA alone 53.1, 76.7 +1 mM MgCl2 Mg2+ 53.6, 76.9 0.5 +1 mM MnCl2 Mn2+ 76.4 23.3 +1 mM ZnCl2 Zn2+ 77.1 24.0 +1 mM Fe(NO3)3 Fe3+ 76.8 23.7 +1 mM FeCl3 Fe3+ 76.7 23.6 +1 mM FeCl2 Fe2+ 76.7 23.6
