Previous Article | Next Article 
Clinical and Vaccine Immunology, April 2009, p. 515-520, Vol. 16, No. 4
1071-412X/09/$08.00+0 doi:10.1128/CVI.00383-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Lateral Flow Immunoassay for Diagnosis of Trypanosoma cruzi Infection with High Correlation to the Radioimmunoprecipitation Assay
Raymond L. Houghton,1*
Yvonne Y. Stevens,1
Kathryn Hjerrild,1
Jeff Guderian,2
Masahiko Okamoto,1
Mazbahul Kabir,1
Steven G. Reed,2
David A. Leiby,3
W. John W. Morrow,1
Myriam Lorca,4 and
Syamal Raychaudhuri1
InBios International, Inc., Seattle, Washington,1
Infectious Disease Research Institute, Seattle, Washington,2
American Red Cross, Rockville, Maryland,3
Faculty of Medicine, University of Chile, Santiago, Chile4
Received 15 October 2008/
Returned for modification 12 November 2008/
Accepted 2 February 2009

ABSTRACT
The incidence of blood donors seropositive for
Trypanosoma cruzi in North America has increased with population migration and
more rigorous surveillance. The United States, considered nonendemic
for
T. cruzi, could therefore be at risk to exposure to parasite
transmission through blood or organ donations. Current tests
show variable reactivity, especially with Central American sera.
Here we describe the development of a lateral flow immunoassay
for the rapid detection of
T. cruzi infection that has a strong
correlation to the radioimmunoprecipitation assay (RIPA) "gold
standard" in the United States. Such a test could have utility
in small blood banks for prescreening donors, as well as in
cardiac transplantation evaluation.
T. cruzi consensus and/or
RIPA-positive sera from Central and South America were evaluated
in enzyme immunoassays (EIAs). These included commercial panels
from Boston Biomedica, Inc. (BBI) (
n = 14), and HemaBio (
n =
21). Other sources included RIPA-positive sera from the American
Red Cross (ARC) (
n = 42), as well as from Chile. Sera were tested
with the multiepitope recombinant TcF. All but one of the BBI
samples were positive and 7 of 21 HemaBio samples and 6 of 42
ARC samples were low positive or negative. This observation
indicated the need for additional antigens. To complement TcF
reactivity, we tested the sera with peptides 30, 36, SAPA, and
1.1, 1.2, and 1.3 His fragments of 85-kDa trans-sialidase. We
identified a promising combination of the tested antigens and
constructed a single recombinant protein, ITC6, that enhanced
the relative sensitivity in U.S. blood donor sera compared to
that of TcF. The data on its evaluation using RIPA-confirmed
positive sera in EIA and lateral flow immunoassay studies are
presented, along with an additional recombinant protein, ITC8.2,
with two additional sequences for peptide 1 and Kmp-11. The
latter, when evaluated in a dipstick assay with consensus positive
sera, had a sensitivity of 99.2% and a specificity of 99.1%.

INTRODUCTION
Trypanosoma cruzi infection is endemic in Latin America and
is the causative agent of Chagas' disease. The parasite is transmitted
to humans via direct contact with feces from infected the reduviid
bug, congenitally or via blood transfusion (
24,
31,
32,
39).
The latter has become the most prevalent route of infection
and in some countries up to 10% of the blood supply is affected.
After infection an acute phase of disease occurs for 1 to 2
months, after which the disease frequently resolves, and individuals
become asymptomatic for long periods of time (years). During
this phase individuals have low levels of detectable parasite
and measurable antibody titers. Up to a quarter of this group
will progress to chronic disease, resulting frequently in cardiac
failure and death. There is growing evidence that with increased
migration of populations, people in countries such as the United
States, considered nonendemic for
T. cruzi, could be at risk
for exposure to parasite transmission through blood donations
(
20). Any test developed also needs to be capable of detecting
different clones of
T. cruzi that are evident in Central America
as opposed to most of South America (
27). It is also evident
from other studies with various recombinant proteins and sera
from Central and South America that wide geographical differences
in reactivity are observed (
36,
37).
Several methods for the diagnosis of T. cruzi infection are available but not applicable for field testing. These include the enzyme-linked immunosorbent assay (ELISA), the immunofluorescence antibody test (IFAT), or the indirect hemagglutination test (4, 7, 19, 34). Hemoculture and xenodiagnosis are frequently used as reference standards of parasite presence, but they suffer from variability in sensitivity and are not recommended for routine diagnosis (30). Other researchers are evaluating dipstick assays with other sets of antigens than those discussed here, but there are still issues of sensitivity and specificity over a broad geographical area (26, 29). More recently, radioimmunoprecipitation assay (RIPA) has been used in the United States (19) as the "gold standard. Although these tests are sensitive and specific, there is a need for a rapid, sensitive, and specific diagnostic test for screening surveys or use in small rural clinics or in cardiac transplantation situations. Such a test needs to maintain a high level of sensitivity and specificity irrespective of geographical location.
TcF is a multiepitope recombinant protein containing four immunodominant repeating peptide epitopes, and its reactivity and that of related peptides with Chagas' serum has been described by various groups in the literature (2, 6, 9-13, 28). It is reactive in enzyme immunoassay (EIA) with T. cruzi-positive sera with a high level of sensitivity and specificity, particularly with South American sera, e.g., in sera from Brazil, which were used in initially identifying many of the epitopes. On closer inspection, TcF was found to vary in sensitivity or intensity of signal when tested against T. cruzi-positive sera from the U.S. and Central American blood donors or patients. This might indicate their infection with a different T. cruzi clone (27). This prompted the search for additional epitopes that would complement TcF and that subsequently could be incorporated into a next-generation multiepitope recombinant protein. The data presented here describe (i) the selection of antigens complementary to TcF; (ii) the development of a novel multiepitope recombinant protein, ITC6, and, subsequently, ITC8.2, incorporating complementary sequences; and (iii) the development of a prototype lateral flow assay for the detection of T. cruzi antibodies in serum.
This novel assay demonstrated increased sensitivity and signal in T. cruzi-positive U.S. blood donors and Central American sera than were previously seen with TcF alone.

MATERIALS AND METHODS
TcF or ITC6 or ITC8.2 recombinant EIA.
The TcF, ITC6, and 8.2 and other recombinant protein and peptide
EIAs were performed as follows. Microtiter plates (Immulon-2;
flat bottom, high binding) were coated with recombinant proteins
at 100 ng/well overnight at 4°C in a carbonate/bicarbonate
buffer (pH 9.6). After three washes with phosphate-buffered
saline containing 0.05% Tween 20 (PBST), the plates were blocked
with PBS containing 1% bovine serum albumin and 0.05% Tween
20 for 1 h. Serum samples were then added at a 1/50 dilution
and incubated for 30 min at 37°C, followed by six washes
with PBST. Goat anti-human immunoglobulin G (IgG)-horseradish
peroxidase (1/50,000) was then added to the plate, followed
by incubation for 30 min at 37°C. After six washes in PBST,
the plate was developed with TMB (3,3',5,5'-tetramethylbenzidine)
substrate for 15 min at ambient temperature and then stopped
with 1 N H
2SO
4. The plates were immediately read at an optical
density at 450 nm (OD
450). The cutoff was calculated as the
mean of the negative population plus three standard deviations.
ITC lateral flow immunoassay.
A lateral flow assay was performed with the ITC recombinants as the solid-phase antigen in the test line. An affinity-purified goat anti-human IgG antibody was labeled with colloidal gold and used as the mobile phase. The control line comprised recombinant protein A.
ITC recombinant proteins were coated on the membrane at a concentration of 0.35 mg/ml as the test line. Colloidal gold conjugate was prepared by using goat anti-human IgG and adding gold salt. After incubation, bovine serum albumin was added as a blocking reagent. The gold was diluted to the appropriate OD at 520 to 540 nm using gold suspension buffer at an appropriate concentration. The antibody gold conjugate was then sprayed onto the conjugate pad. The control line was recombinant protein A sprayed at a concentration of 1 mg/ml. Human sera (25 µl) were applied to the sample pad, followed by 3 drops of chase buffer. In recent studies, the intensity of the rapid test line has been compared to the intensity of lines of a dilution panel with a scale of 0 to 14 based on intensity. A score of 14 is the highest intensity and would be similar to that seen in the control line. A photograph of the dilution panel was used as a reference. Any line faint or otherwise was considered a positive result. Also, it is recommended that the tests should be read by someone other than the one who runs the samples to remove any subjectivity. Dipsticks are read at 15 min but are stable if air dried and maintained dry and free of exposure to moisture.
ITC recombinant proteins.
TcF was expressed in E. coli with His6 tags and purified by nickel affinity chromatography as previously described (9-13). ITC6 and ITC8.2 were also initially expressed with a His6 tag. Subsequently, ITC8.2 was expressed with an appropriate tag as described below to facilitate secretion and yield. The components of the ITC6 and ITC8.2 recombinants compared to TcF are outlined in Fig. 1.
His-ITC8.2.
The ITC8.2 insert was cloned between the NdeI and XhoI sites
of a modified pET28 vector lacking the N-terminal His
6 and T7
tags present in the commercial vector (Novagen, La Jolla, CA).
An N-terminal His tag was added to the ITC8.2 sequence via PCR
amplification prior to subcloning. The sequence-verified pET28/Itc8.2
DNA was transformed into the Rosetta2 (DE3)/pLysS expression
strain (Novagen), and transformants were maintained on LB-kanamycin
(50 µg/ml)-chloramphenicol (34 µg/ml). For ITC8.2
protein expression, an overnight culture of Rosetta2 (DE3)/pLysS/pET28Itc8.2
cells was subcultured at a ratio of 1:80 (vol/vol) in selective
medium, and the new culture was grown at 37°C to an OD
560 of 0.6 to 0.7. Expression was induced after the addition of
IPTG (isopropyl-β-
D-thiogalactopyranoside) to 1 mM, and
cells were harvested at 3 h postinduction by centrifugation
at 6,000 rpm for 10 min. Purification was performed on a nickel
affinity columns by using an imidazole buffer gradient.
SUMO-ITC8.2.
The ITC8.2 insert was amplified via PCR using the primer pair GGTGATAAGCCTAGCCCATTTGGT (sense) and CAATTGCTCGAGTTACGCGACAAAATCGCT (antisense) and an annealing temperature of 68°C. The PCR product was gel purified and TA cloned into pETSUMO by using a Champion pETSUMO protein expression kit (Invitrogen) according to the manufacturer's directions. Transformants were screened by PCR for the presence of insert in the correct orientation, and DNA was extracted from one positive clone and confirmed to be correct by sequencing. The sequence-verified plasmid was transformed into the BL21(DE3) strain for expression and maintained on Luria broth with kanamycin (50 µg/ml) and glucose. For SUMO/Itc8.2 protein expression, an overnight culture of BL21(DE3)/pETSUMOItc8.2 cells was subcultured in selective media and expression was induced after the addition of 1 M IPTG. Cells were harvested at 3 h postinduction by centrifugation at 6,000 rpm for 10 min. Purification was performed on a nickel affinity columns using an imidazole buffer gradient after protease removal of the SUMO.
RIPA.
RIPAs were performed by David Leiby at the ARC, Rockville, MD (19), using three negative and three positive control samples. Briefly, the assay detects two T. cruzi-specific glycoproteins of 72 and 90 kDa identified in radioautographs after radioimmunoprecipitation with T. cruzi-positive sera (17, 18). Where possible, the radioautographs were graded by their intensity.
EIA and IFAT Chile.
The samples from Chile were evaluated by Myriam Lorca, University of Chile, using immunofluorescence titration (i.e., the IFAT) and confirmed by using EIA. The IFAT was performed according to the Camargo methodology (4), as modified by the Lorca group (24). Epimastigotes of T. cruzi from Diamond cultures were used. After three washes, the cultures were fixed with 2% formol in PBS. The serum samples were diluted in PBS (pH 7.2; 1/20 or serial dilutions) and incubated with the antigen at 37°C for 45 min. After two washes the slides were incubated with the second antibody (fluorescein isothiocyanate-labeled anti-human IgG) plus Evans blue as a contrast (25). The slides were read in UV microscope (Olympus PS-2D) at a magnification of x40. The EIA was performed according to the routine methodology (7) using whole extract of epimastigotes of T. cruzi (2 µg/ml). Plates were blocked with nonfat dried milk diluted in PBS. Serum dilutions were made in PBS-nonfat dried milk.
Serum samples.
Several panels were available for testing. Forty-two samples were received from the ARC that had tested RIPA positive. These included several donors of Central American origin. A panel of 15 sera primarily from Venezuela, Nicaragua, Honduras, and Argentina (14 positive and 1 negative) was available from Boston Biomedica, Inc., West Bridgewater, MA. A panel of 21 sera was available from HemaBio (formerly Teragenix), and these included sera from Central and South America. Myriam Lorca also provided us with a panel of 25 positive sera by epimastigote ELISA and IFAT that included known peptide 1, peptide 2, and SAPA (shed acute-phase antigen) reactive sera. She also performed initial evaluations in Chile of an ITC8.2 dipstick with an extensive panel of sera shown to be consensus positive by the IFAT and/or EIA. This panel included Chagas' disease patients (n = 118) that were chronic asymptomatic (n = 112), cardiopathy (n = 4), or digestive symptomatic (n = 2) samples, as well as nonendemic controls and samples with other parasitic infections, e.g., toxoplasmosis, leishmaniasis, and nonparasitic diseases (e.g., syphilis) and rheumatoid factor (n = 106). Nonendemic controls for the present study were from Southern Chile, and all were shown to be IFAT and EIA negative, as were samples from other parasitic and nonparasitic infections. All of the panels of sera evaluated at InBios were tested by D. Leiby in a RIPA to confirm their status. Where possible, the radioautographs were graded based on intensity. Control sera were also obtained from Seracare. Serum samples were collected by venipuncture, separated by centrifugation, and stored at –20°C until used.
For the serum samples used for cross-reactivity studies with visceral leishmaniasis (VL), the Chagas positive, controls, and VL samples were tested with the Abbott Chagas ELISA and with the rK39 dipstick assay for VL (3). All VL sera were from Salvador, Brazil.

RESULTS
Several recombinant antigens and peptides were evaluated to
determine their ability to complement TcF in detecting
T. cruzi-positive
sera. These included peptides 30, 36, and SAPA (
22,
23,
38).
Other recombinant antigens included but were not restricted
to 1.1, 1.2, and 1.3 His. 1.1 His is a 30-kDa fragment of a
family member of the abundant 85-kDa trans-sialidase membrane
protein, 1.2 His is a 48-kDa fragment of a second family member,
and 1.3 His is a 30-kDa fragment of a third family member (
14-
16).
Table
1 summarizes the example of complementation of the key
antigens with TcF low or nonreactive sera that were determined
to be RIPA positive. These were sera from U.S. blood donors
primarily of Central American origin, as well as four consensus-positive
sera from Brazil.
The data, expressed as signal/cutoff (S/CO) ratios to enable
comparison of the reactivities, indicate that peptides 30, 36,
and SAPA all contributed to complementing the reactivity of
TcF. For example, in Table
1 the TcF-negative sera RR26 and
RR34 were complemented with peptide 30, and RR57 and RR86 were
complemented with peptide 36. SAPA also further enhanced activity,
as seen in sera, e.g., RR52. The His proteins showed some reactivity
with the sera but were always positive by SAPA, peptide 30,
or peptide 36 and did not appear to improve overall reactivity.
Based on these complementation studies and other similar evaluations,
a new multiepitope antigen ITC6 was constructed and expressed
as a recombinant protein in an
E. coli expression system as
described in Materials and Methods. This protein included peptide
30, peptide 36, and SAPA in conjunction with the four epitopes
of TcF (
11-
13). The comparison of ITC6 reactivity versus TcF
on RIPA-positive donor samples from the ARC, as well as the
BBI panel which was confirmed positive with RIPA, are illustrated
in Table
2. Significant improvements in reactivity were observed
in problematic sera, particularly in many of the low-reactive
or TcF-negative ARC sera. For instance, the TcF-negative sera
or equivocal samples in Table
1 (RR26, RR34, RR52, RR57, RR86,
RR94, and RR66) were all positive with ITC6, with S/CO values
ranging from 1.695 to 12.206. Comparison of TcF and ITC6 in
the ARC and BBI panels indicated an increased sensitivity (49/56
to 56/56) and significant increases in the S/CO, as indicated
by the mean S/CO and 99th percentile. This finding of improved
reactivity with ITC6 was further evident in a comparative study
of RIPA with TcF EIA and ITC6 EIA and ITC6 dipstick in the serum
panels, as outlined in Table
3, where TcF was reactive with
93 of 102 RIPA-positive sera compared to 101 of 102 sera for
the ITC6 EIA or dipstick. One sample in the Hemabio panel that
was equivocal by RIPA (63225) was negative by both TcF EIA and
the ITC6 rapid test.
Though ITC6 improved sensitivity versus TcF, it was still considered
prudent to add additional peptides. M. Lorca and coworkers have
strongly indicated the need to include peptide 1 in
T. cruzi assays (
22,
38). These researchers provided a panel of 25 sera
positive by epimastigote EIA or IFAT. The sera were also tested
with peptide 1, peptide 2, and SAPA.
Within this panel three sera were only reactive with peptide 1 out of the peptide antigens tested by M. Lorca, so it was decided to include this antigen in a new recombinant ITC8.2 along with the Kmp-11 peptide. The latter epitope has been shown to react specifically with >50% of T. cruzi sera when chemically immobilized on a 96-well plate (33, 35). By including the Kmp-11 sequence in the multiepitope recombinant, it was not subject to the need for such immobilization. The new recombinant ITC8.2 was initially made with a His6 tag but was subsequently made with a SUMO tag, which was then cleaved as described in Materials and Methods. The sequence of the His6-tagged ITC8.2 is shown in Fig. 1B. As is evident from Table 3, this recombinant antigen reacted with all of the peptide 1-positive sera in EIAs, although to date no serum reactive with only peptide 1 or Kmp-11 has been identified. To confirm the reactivity of a peptide 1-reactive serum with ITC8.2, a peptide 1-reactive serum was affinity purified on a peptide 1 affinity column. This serum was then shown to react in an EIA with peptide 1 and ITC8.2 but not with ITC6, which lacks the peptide 1 sequence. ITC8.2 dipsticks were prepared and compared to the reactivity of TcF and ITC6 EIA, RIPA, and ITC6 dipsticks with the serum panels. Table 3 shows the ITC8.2 dipstick reactivity, along with the ITC6 dipstick reactivity, compared to RIPA. In both cases 101 of 102 sera were positive, and both showed improved reactivity over TcF. In addition, Fig. 2 shows a comparison of the intensities of dipstick reactivity for ITC6 and ITC8.2 and indicates that, in general, increased intensity is seen in ITC8.2 dipsticks versus ITC6 dipsticks without affecting the background. Whether this is due to the Kmp-11 or peptide 1 reactivity inclusion is uncertain at this time due to the lack of a Kmp-11- or peptide 1-only reactive serum. ITC8.2 was then chosen for further studies, and a more extensive evaluation of the ITC8.2 dipstick was performed in Chile. Table 4 shows the reactivity of the ITC8.2 dipstick test with serum samples from 118 IFAT-positive Chagas' sera, as well as 106 control sera that include sera with rheumatoid factor, toxoplasmosis, syphilis, nonparasitic diseases, and cancers. The ITC8.2 dipstick was positive in 116 of the IFAT-positive sera. Of the two sera that were discrepant, one was negative by EIA (epimastigotes) and the other was positive. The single false-positive result in the dipstick assay was confirmed to be ELISA negative. The initial positive concordance was 98.3%, and the negative concordance was 99.1%, with a total concordance of 98.7%. If IFAT and EIA (epimastigotes) are used in combination (consensus positive), the positive concordance was 99.2%, and the negative concordance was 99.1%. The total concordance increased to 99.1%. The discrepant samples could indicate the absence of antibodies to the ITC8.2 epitopes, inaccessibility of epitopes in the recombinant protein to serum antibodies, or an extremely low antibody titer.
View this table:
[in this window]
[in a new window]
|
TABLE 4. ITC8.2 dipstick reactivity with Chilean positive and negative sera compared to IFAT and IFAT/EIA results with epimastigotesa
|
To determine the potential cross-reactivity with VL, sera from
20 individuals with rK39-positive sera were tested in the ITC8.2
Chagas dipstick along with 10 Chagas positive sera and 10 control
sera. The data shown in Table
5 indicate no cross-reactivity
with VL-positive sera. This finding is in contrast to some commercial
ELISAs that show high cross-reactivity with VL-positive sera
(
10).

DISCUSSION
EIA was used to identify additional epitopes that complemented
the multiepitope recombinant protein TcF and improved detection
of
T. cruzi-positive sera from Central America. From these studies
peptides 1, 30, 36, and SAPA were identified as complementary
in detecting antibodies to
T. cruzi in serum samples. Based
on these studies, multiepitope recombinant proteins (ITC6 and
ITC8.2) have been synthesized containing the components of TcF
and some or all of the additional epitopes described. ITC6 incorporated
peptides 30, 36, and SAPA, and ITC8.2 further included peptides
1 and Kmp-11. Peptide 1 has been described as being reactive
with a large percentage of symptomatic and asymptomatic patients
with Chagas' disease (
22,
23). Kmp-11 is a cytoskeletal associated
protein that is a major component of the cell membrane, and
a C terminus peptide has been shown to be reactive with >50%
of chagasic sera (
33,
35). These newly developed recombinant
proteins, in particular ITC8.2, have been used in the development
of a prototype lateral flow assay for the detection of
T. cruzi antibodies in serum. The ITC8.2 assay was shown to have a high
correlation with the confirmatory RIPA used in the United States
and demonstrates improved reactivity with
T. cruzi-positive
sera from Central American and U.S. blood donors compared to
TcF. The dipstick test had a specificity of 99.1% and a sensitivity
of 98.3% compared to IFAT, and 99.1 and 99.2%, respectively,
compared to IFAT in combination with EIA (epimastigotes) (Table
4). In the studies described here, the ITC8.2 dipstick also
showed good correlation with RIPA. It was positive with 25 of
25 RIPA-positive sera from Chile, 14 of 14 BBI sera, and 20
of 21 sera from the HemaBio panel (Table
3). Serum 63225 in
the latter panel was equivocal by RIPA and was borderline positive
by the Hemagen EIA as provided in the HemaBio specifications.
The EIA data indicate that both ITC6 and ITC8.2 have improved
reactivity over TcF and that ITC8.2 is the antigen of choice
in developing the dipstick assay. These assays could become
the first choice for screening purposes in disease surveillance
or intervention programs and could have utility in cardiac and
other organ transplantations (
1,
21). The assay is designed
for point of care, epidemiological settings, and remote diagnostic
laboratories and for testing on an individual basis. Although
it could potentially be used for pretesting blood donors, removing
an individual testing positive from a blood donor pool should
first be considered for retesting with a commercially available
ELISA.
Serological expression cloning with TcF-negative or TcF low-reactive sera that were identified while evaluating the additional sequences has also been performed, and additional, potentially complementary antigens to TcF have been identified. Discussion of these findings, however, will be the subject of a separate publication. In addition, studies are currently under way to evaluate the use of whole-blood samples in the ITC8.2 dipstick assay. The studies presented here show the utility of the ITC6 and ITC8.2 antigens in the detection of human Chagas' disease. Other investigators have also demonstrated the utility of the ITC6 and 8.2 antigens in detecting T. cruzi antibodies in canines (5) and in a case of autochthonous transmission of T. cruzi in Louisiana (8).

ACKNOWLEDGMENTS
We thank Raodoh Mohamath at the Infectious Disease Research
Institute, Seattle, WA, for assisting in developing recombinant
proteins and performing the serological expression cloning.
We also thank our collaborators at the ARC for samples and for
performing RIPA assays.
This study was supported by NIH grant R44 AI0522683-02 (S.R.).

FOOTNOTES
* Corresponding author. Mailing address: InBios International, Inc., 562 First Avenue South, Ste. 600, Seattle, WA 98104. Phone: (206) 344-5821, ext. 29. Fax: (206) 344-0081. E-mail:
raymond{at}inbios.com 
Published ahead of print on 11 February 2009. 

REFERENCES
1 - Altclas, J. D., L. Barcan, C. Nagel, R. Lattes, and A. Riarte. 2007. Organ transplantation and Chagas disease. JAMA 298:2171-2181.[Abstract/Free Full Text]
2 - Betonico, G. N., E. O. Miranda, D. A. O. Silva, R. Houghton, S. G. Reed, A. Campos-Neto, and J. R. Mineo. 1999. Evaluation of a synthetic tripeptide as antigen for detection of IgM and IgG antibodies to Trypanosoma cruzi in serum samples from patients with Chagas' disease or viral diseases. Trans. R. Soc. Trop. Med. Hyg. 93:603-606.[CrossRef][Medline]
3 - Boelaert, M., S. El-Safi, A. Hailu, M. Mukhtar, S. Rijal, S. Sundar, M. Wasunna, A. Aseffa, J. Mbui, J. Menten, P. Desjeux, and R. W. Peeling. 2008. Diagnostic tests for kala-azar: a multi-centre study of the freeze-dried DAT, rK39 strip test and KAtex in East Africa and the Indian subcontinent. Trans. R. Soc. Trop. Med. Hyg. 102:32-40.[CrossRef][Medline]
4 - Camargo, M., E. Segura, I. Kagan, J. Souza, J. Carvalheiro, J. Yanovsky, and M. Guimaraes. 1986. Three years collaboration on the standardization of Chagas disease serodiagnosis in the Americas: an appraisal. Bull. PAHO 20:233-244.
5 - Cardinal, M. V., R. Reithinger, and R. E. Gürtler. 2006. Use of an immunochromatographic dipstick test for rapid detection of Trypanosoma cruzi in sera from animal reservoir hosts. J. Clin. Microbiol. 44:3005-3007.[Abstract/Free Full Text]
6 - Chico, M., C. Sandoval, A. Guevara, M. Calvopina, P. J. Cooper, S. G. Reed, and R. H. Guderian. 1997. Chagas' disease in Ecuador: evidence for disease transmission in an indigenous population in the Amazon region. Mem. Inst. Oswaldo Cruz 92:317-320.[Medline]
7 - Contreras, M. C., P. Salinas, L. Sandoval, and F. A. Solis y Rojas. 1992. Usefulness of the ELISA IgG test in sera and filter paper blood eluates in the Chagas diagnosis. Bol. Chil. Parasitol. 47:76-81.[Medline]
8 - Dorn, P. L., L. Perniciaro, M. J. Yabsley, D. M. Roellig, G. Balsamo, J. Diaz, and D. Wesson. 2007. Autochthonous transmission of Trypanosoma cruzi, Louisiana. Emerg. Infect. Dis. 13:605-607.[Medline]
9 - Ferreira, A. W., Z. R. Belem, E. A. Lemos, S. G. Reed, and A. Campos-Neto. 2001. Enzyme-linked immunosorbent assay for serological diagnosis of Chagas' disease employing a Trypanosoma cruzi recombinant antigen that consists of four different peptides. J. Clin. Microbiol. 39:4390-4395.[Abstract/Free Full Text]
10 - Gorlin, J., S. Rossmann, G. Robertson, F. Stallone, N. Hirschler, K. A. Nguyen, R. Gilcher, H. Fernandes, S Alvey, P. Ajongwen, P. Contestable, and H. Warren. 2008. Evaluation of a new Trypanosoma cruzi antibody assay for blood donor screening. Transfusion 48:531-540.[CrossRef][Medline]
11 - Houghton, R. L., D. R. Benson, L. Reynolds, P. McNeill, P. Sleath, M. Lodes, Y. A. W. Skeiky, D. Leiby, R. Badaro, and S. G. Reed. 1999. A multiepitope peptide ELISA for the detection of antibodies to Trypanosoma cruzi in RIPA confirmed and consensus positive sera. J. Infect. Dis. 179:1226-1234.[CrossRef][Medline]
12 - Houghton, R. L., D. R. Benson, L. Reynolds, P. McNeill, P. Sleath, M. Lodes, Y. A. W. Skeiky, R. Badaro, A. U. Krettlie, and S. G. Reed. 2000. Multiepitope synthetic peptide and recombinant protein for the detection of antibodies to Trypanosoma cruzi in patients with treated or untreated Chagas' disease. J. Infect. Dis. 181:325-330.[CrossRef][Medline]
13 - Houghton, R. L., Y. Y. Stevens, J. Guderian, M. Okamoto, M. Kabir, P. Arauz-Ruiz, K. Visona, S. G. Reed, D. A. Leiby, W. J. W. Morrow, and S. Raychaudhuri. 2006. Geographically robust lateral flow immunoassay for diagnosis of T. cruzi infection with high correlation to radio-immunoprecipitation assay (RIPA) Am. J. Trop. Med. Hyg. 75:146. (Abstr.)
14 - Kahn, S., M. Kahn, W. C. van Voorhis, A. Goshorn, A. Strand, N. Hoagland, H. Eisen, and S. Pennathur. 1993. SA85-1 proteins of Trypanosoma cruzi lack sialidase activity. Mol. Biochem. Parasitol. 60:149-152.[CrossRef][Medline]
15 - Kahn, S., T. G. Colbert, J. C. Wallace, N. A. Hoagland, and H. Eisen. 1991. The major 85-kDa surface antigen of the mammalian-stage forms of Trypanosoma cruzi is a family of sialidases. Proc. Natl. Acad. Sci. USA 88:4481-4485.[Abstract/Free Full Text]
16 - Kahn, S., W. C. van Voorhis, and H. Eisen. 1990. The major 85-kDa surface antigen of the mammalian form of Trypanosoma cruzi is encoded by a large heterogeneous family of simultaneously expressed genes. J. Exp. Med. 172:589-597.[Abstract/Free Full Text]
17 - Kirchhoff, L. V., A. A. Gam, R. de Gusmao, R. S. Goldsmith, J. M. Rezende, and A. Rassi. 1987. Increased specificity of serodiagnosis of Chagas' disease by detection of antibody to the 72- and 90-kilodalton glycoproteins of Trypanosoma cruzi. J. Infect. Dis. 155:561-564.[Medline]
18 - Kirchhoff, L. V. 1990. Trypanosoma species (American trypanosomiasis, Chagas' disease): biology of trypanosomes, p. 2077. In G. L. Mandell, R. G. Douglas, and J. E. Bennett (ed.), Principles and practice of infectious diseases, 3rd ed. Churchill Livingstone, New York, NY.
19 - Leiby, D. A., S. Wendel, D. T. Takaoka, R. M. Fachini, L. C. Oliveira, and M. A. Tibbals. 2000. Serologic testing for Trypanosoma cruzi: comparison of radioimmunoprecipitation assay with commercially available indirect immunofluorescence assay, indirect hemagglutination assay and enzyme-linked immunosorbent assay kits. J. Clin. Microbiol. 38:639-642.[Abstract/Free Full Text]
20 - Leiby, D. A., E. J. Read, B. A. Lenes, A. J. Yund, R. J. Stumpf, L. V. Kirchhoff, and R. Y. Dodd. 1997. Seroepidemiology of Trypanosoma cruzi, etiologic agent of Chagas' disease in US blood donors. J. Infect. Dis. 176:1047-1052.[Medline]
21 - Leiby, D. A., F. J. Rentas, K. E. Nelson, V. A. Stambolis, P. M. Ness, C. Parnis, H. A. McAllister, D. H. Yawn, R. J. Stumpf, and L. V. Kirchhoff. 2000. Evidence of Trypanosoma cruzi infection (Chagas' disease) among patients undergoing cardiac surgery. Circulation 102:2978-2982.[Abstract/Free Full Text]
22 - Lorca, M., A. Gonzalez, V. Reyes, C. Veloso, U. Vergara, and C. Frasch. 1993. The diagnosis of chronic Chagas' disease using recombinant antigens of Trypanosoma cruzi. Rev. Med. Chile 121:363-368.[Medline]
23 - Lorca, M., A. Gonzalez, C. Veloso, V. Reyes, and U. Vergara. 1992. Immunodetection of antibodies in sera from symptomatic and asymptomatic Chilean Chagas' disease patients with Trypanosoma cruzi recombinant antigens. Am. J. Trop. Med. 46:44-49.[Abstract/Free Full Text]
24 - Lorca, M., and E. Thiermann. 1994. Congenital Chagas disease and its serological diagnosis through conventional serology and methods of molecular biology, p. 160-166. In R. Ehrlich and A. Nieto (ed.), Biology of parasitism. Trilce, Montevideo, Uruguay.
25 - Luquetti, A., and A. Rassi. 2000. Diagnóstico laboratorial da infeccion pelo Trypanosoma cruzi, p. 344-378. In Z. Brenner, Z. Andrade, and M. Barral-Neto (ed.), Trypanosoma cruzi e doença de Chagas, 2nd ed. Guanabara Koogan, Rio de Janeiro, Brazil.
26 - Luquetti, A. O., C. Ponce, E. Ponce, J. Esfandiari, A. Schijman, S. Revollo, N. Anez, B. Zingales, R. Rangel-Aldao, A. Gonzales, M. J. Levin, E. S. Umezawa, and J. F. da Silveira. 2003. Chagas' disease diagnosis: a multicentric evaluation of Chagas Stat-Pak, a rapid immunochromatographic assay with recombinant proteins of Trypanosoma cruzi. Diagn. Microbiol. Infect. Dis. 46:265-271.[CrossRef][Medline]
27 - Machadi, C. A., and F. J. Ayala. 2001. Nucleotide sequences provide evidence of genetic exchange among distantly related lineages of Trypanosoma cruzi. Proc. Natl. Acad. Sci. USA 98:7396-7401.[Abstract/Free Full Text]
28 - Peralta, J. M., M. G. Teixera, W. G. Shreffler, J. B. Pereira, J. M. Burns, Jr., P. R. Sleath, and S. G. Reed. 1994. Serodiagnosis of Chagas' disease by enzyme-linked immunosorbent assay using two synthetic peptides as antigens. J. Clin. Microbiol. 32:971-974.[Abstract/Free Full Text]
29 - Ponce, C., E. Ponce, E. Vinelli, A. Montoya, V. de Aguilar, A. Gonzales, B. Zingales, R. Rangel-Aldao, M. J. Levin, J. Esfandiari, E. S. Umezawa, A. O. Luquetti, and J. F. da Silveira. 2005. Validation of a rapid and reliable test for the diagnosis of Chagas' disease by detection of Trypanosoma cruzi-specific antibodies in the blood of donors and patients in Central America. Clin. Microbiol. 43:5065-5068.[CrossRef]
30 - Portela-Lindoso, A. A., and M. A. Shikanai-Yasuda. 2003. Chronic Chagas's disease: from xenodiagnosis and hemoculture to polymerase chain reaction. Cad. Saude Publica 37:107-115.
31 - Schmunis, G. A. 1991. Trypanosoma cruzi, the etiologic agent of Chagas' disease: status in the blood supply in endemic and non-endemic countries. Transfusion 31:547.[CrossRef][Medline]
32 - Tanowitz, H. B., L. V. Kirchhoff, D. Simon, S. A. Morris, L. M. Weiss, and M. Wittner. 1992. Chagas' disease. Clin. Microbiol. Rev. 5:400-419.[Abstract/Free Full Text]
33 - Thomas, M. C., M. V. Longobardo, E. Carmelo, C. Maranon, L. Planelles, M. E. Patarroyo, C. Alonso, and M. C. Lopez. 2001. Mapping of the antigenic determinant of the Trypanosoma cruzi kinetoplastid membrane protein-11. Identification of a linear epitope specifically recognized by human chagasic sera. Clin. Exp. Immunol. 123:465-471.[CrossRef][Medline]
34 - Tobler, L. H., P. Contestable, L. Pitina, H. Groth, S. Shaffer, G. R. Blackburn, H. Warren, S. R. Lee, and M. P. Busch. 2007. Evaluation of a new enzyme-linked immunosorbent assay for detection of Chagas antibody in U.S. blood donors. Transfusion 47:90-96.[CrossRef][Medline]
35 - Trujillo, C., R. Ramirez, I. D. Velez, and C. Berberich. 1999. The humoral response to the kinetoplastid membrane protein 11 in patients with American leishmaniasis and Chagas' disease: prevalence of IgG subclasses and mapping of epitopes. Immunol. Lett. 70:203-209.[CrossRef][Medline]
36 - Umezawa, E. S., S. F. Bastos, M. E. Camargo, L. M. Yamauchi, M. R. Santos, A. Gonzalez, B. Zingales, M. J. Levin, O. Sousa, R. Rangel-Aldao, and J. F. da Silveira. 1999. Evaluation of recombinant antigens for the serodiagnosis of Chagas disease in South and Central America. J. Clin. Microbiol. 37:1554-1560.[Abstract/Free Full Text]
37 - Umezawa, E. S., A. O. Luquetti, G. Levitus, C. Ponce, E. Ponce, D. Henriquez, S. Revollo, B. Espinoza, O. Sousa, B. Khan, and J. F. da Silveira. 2004. Serodiagnosis of chronic and acute Chagas' disease with Trypanosoma cruzi recombinant proteins: results of a collaborative study in six Latin American countries. J. Clin. Microbiol. 42:449-452.[Abstract/Free Full Text]
38 - Vergara, U., C. Veloso, A. Gonzalez, and M. Lorca. 1992. Evaluation of an enzyme-linked immunoabsorbent assay for the diagnosis of Chagas' disease using synthetic peptides. Am. J. Trop. Med. Hyg. 46:39-43.[Abstract/Free Full Text]
39 - Wendel, S., and A. L. Gonzaga. 1993. Chagas' disease and blood transfusion: a New World problem? Vox Sang 64:1-12.[Medline]
Clinical and Vaccine Immunology, April 2009, p. 515-520, Vol. 16, No. 4
1071-412X/09/$08.00+0 doi:10.1128/CVI.00383-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.