This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lenz, L. L.
Right arrow Articles by Calendar, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lenz, L. L.
Right arrow Articles by Calendar, R.

 Previous Article  |  Next Article 

Clinical and Vaccine Immunology, September 2008, p. 1414-1419, Vol. 15, No. 9
1071-412X/08/$08.00+0     doi:10.1128/CVI.00208-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Stable Integration Vector for Nutrient Broth-Based Selection of Attenuated Listeria monocytogenes Strains with Recombinant Antigen Expression{triangledown}

Laurel L. Lenz,1,2* William A. Huang,1 Chenghui Zhou,3 Zhongxia Li,3 and Richard Calendar1

Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, California 94720,1 Integrated Department of Immunology, National Jewish Medical and Research Center, and University of Colorado, Denver, Denver, Colorado 80206,2 Department of Microbiology, University of Pennsylvania, Philadelphia, Pennsylvania 191043

Received 4 June 2008/ Accepted 11 July 2008


arrow
ABSTRACT
 
Recombinant Listeria monocytogenes strains induce strong cellular immune responses and may prove useful for antigen delivery for the vaccination of humans. However, the genetic systems currently available for the stable expression of recombinant antigens by L. monocytogenes rely on the use of antibiotic resistance genes. We report on a derivative, pPL2dalGlnA, of the Listeria monocytogenes pPL2 integration vector that completely lacks drug resistance genes. The selectable markers in pPL2dalGlnA are glutamine synthetase (GlnA) and alanine racemase (Dal). This novel vector was stably maintained in auxotropic L. monocytogenes strains that normally require D-alanine. The pPL2dalGlnA vector also partially restored the ability of an L. monocytogenes {Delta}dal {Delta}dat strain to colonize the spleens and livers of infected mice. A novel, highly attenuated strain of L. monocytogenes with quadruple deletions was also engineered by deleting the L. monocytogenes actA and plcB virulence genes from a {Delta}dal {Delta}dat strain. Infection of mice with recombinants of this mutant strain that express the antigen from pPL2dalGlnA were shown to elicit CD8+ T-cell responses to human immunodeficiency virus Tat. This vector system is thus useful for stable antigen expression and vaccination studies.


arrow
INTRODUCTION
 
Listeria monocytogenes is a gram-positive bacterium and facultative intracellular parasite of humans and animals. The bacterium expresses a hemolysin (LLO) that enables it to invade and replicate within the cytosol of eukaryotic cells. Similar to the proteins produced by viral infection, the proteins produced by cytosolic L. monocytogenes are processed and presented to the vertebrate immune system by the endogenous major histocompatibility complex (MHC) class I antigen presentation pathway. Peptide-loaded class I MHC molecules that reach the surface of specialized antigen-presenting cells prime naïve CD8+ T cells to expand in number and differentiate into mature long-lived memory cell populations. Several endogenous L. monocytogenes antigens are known to trigger CD8+ T-cell responses that can protect mice from subsequent infections (15). In addition, recombinant proteins expressed by L. monocytogenes can access the endogenous MHC class I presentation pathway and prime protective CD8+ T-cell responses (12, 17). Thus, recombinant L. monocytogenes strains show promise as vaccination vehicles for the generation of CD8+ T-cell responses in humans.

The widespread use of live organisms for antigen delivery in humans currently faces several hurdles. These include the need to engineer attenuated strains that safely and stably express and deliver the foreign antigens of interest. To date, most systems used for recombinant antigen expression in L. monocytogenes have used plasmids with antibiotic resistance markers either to maintain the antigen-encoding plasmids in the cytoplasm of the bacteria or as selectable markers to aid with the isolation of chromosomal integrants of the antigen expression construct (8, 9, 12, 16, 17). While these strategies demonstrate the ability of recombinant L. monocytogenes strains to elicit cell-mediated immune responses to viral and cancer antigens, the currently used plasmid vectors are unstable without constant selection pressure and may be lost from the vaccine bacterial strain during replication within the host. Furthermore, vaccine strains that use antibiotic resistance markers for selection purposes have the potential to transmit resistance genes to other pathogens, undermining the therapeutic usefulness of the respective antibiotics.

The development of genetic systems to integrate antigen expression constructs into the L. monocytogenes genome circumvents several of the problems associated with plasmid instability. However, construction of such vaccine strains traditionally required the time-consuming process of allelic exchange. More recently, a novel integration vector has been developed to permit chromosomal insertions in a single step. This vector, pPL2, has previously been used to stably integrate a variety of genes at a specific site in the chromosome of Listeria monocytogenes (13). However, as with other genetic systems, the engineering of recombinant strains with pPL2 has entailed the use of antibiotic resistance genes as selectable markers.

Here we report on the development of a second-generation pPL2 vector that can be used to engineer recombinant L. monocytogenes vaccine strains in the complete absence of antibiotic resistance markers. This new vector, pPL2dalGlnA, is stably maintained in L. monocytogenes strains cultured in broth and can be used to express antigens. Furthermore, CD8+ T-cell responses specific for human immunodeficiency virus (HIV) Tat antigens were generated upon infection with a novel attenuated L. monocytogenes vaccine strain expressing the HIV Tat antigen from pPL2dalGlnA. Hence, the novel genetic system developed here may prove useful for the vaccination of humans.


arrow
MATERIALS AND METHODS
 
Chemicals, reagents, and animals. Molecular biology reagents were purchased from New England Biolabs (Ipswich, MA) and Promega (Madison, WI). Brain heart infusion (BHI) broth was used for L. monocytogenes cultures and was purchased from Difco Laboratories (a subsidiary of BD Biosciences, San Jose, CA). Components for Luria broth (LB) were purchased from Thermo Fisher Scientific (Pittsburg, PA). Six- to 8-week-old C57BL/6 mice were used for the competitive index infection studies and were purchased from Harlan (Indianapolis, IN). BALB/c mice were used for the immunization studies and were from National Cancer Institute (Frederick, MD). All animal studies were approved by the Institutional Care and Use Committees at the National Jewish Medical and Research Center and the University of Pennsylvania.

Engineering of pPL2dalGlnA vector. To generate pPL2dal, the gram-positive bacterial chloramphenicol transferase (cat) gene of pPL2 was deleted by digestion with KpnI and PvuI and replaced with the L. monocytogenes alanine racemase (dal) gene. The dal gene was amplified by PCR with primers Updal2 (GGGGGTACCAGCTACGAAGGTGTGGGTATTCC) and Downdal2 (GGGCGATCGTTCTAATGGATGTATTTTCTAGGTATGCG). These primers included a KpnI or a PvuI site (the two sites are underlined in the sequences of primers Updal2 and Downdal2, respectively). Subsequently, pPL2dalGlnA was engineered by removing the gram-negative bacterial cat gene from pPL2dal by using NotI and Bst17I and replacing this with the glnA gene cloned from Escherichia coli K-12 strain Top10. The glnA gene was amplified with the primers EcGlnAfor (CCAGTATACACTCCGCTAGCGCTGATCAAACAAGTATTGCAGAGTC) and EcGlnArev (GTAGCGGCCGCGGCAACTAAAACACTTAGAC). The restriction sites for BstZ17I and NotI are underlined in the sequences of primers EcGlnAfor and EcGlnArev, respectively. In primer EcGlnAfor, 17 additional nucleotides from the p15A origin of replication are encoded upstream of the glnA promoter.

Generation of E. coli {Delta}glnA strains for cloning of pPL2dalGlnA. An E. coli {Delta}glnA strain for cloning of pPL2dalGlnA was engineered by deletion of the glnA gene and its promoter by the method of Datsenko and Wanner (6). The primers used for the deletion were ATCACAAACATCCTCCGCAAACAAGTATTGCAGAGTGTGTAGGCTGGAGCTGCTTCG and ACAGGCGAAAAGTTTCCACGGCAACTAAAACACTTACATATGAATATCCTCCTTA. Chloramphenicol resistance was used as the initial selective marker, and the gene for chloramphenicol resistance and was subsequently deleted by flp-frt site-specific recombination (6). The {Delta}glnA strains were constructed in E. coli SURE {Delta}glnA::frt (strain DP-E5136) and MG1655 {Delta}glnA (strain DP-E5266). The nutrient broth used for the selection of glnA was supplemented with 5 g/liter NaCl, 0.2 g/liter MgSO4·7H2O, 0.05 g/liter MnSO4·H2O, and 0.15 g/liter CaCl2.

Generation of L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB. A highly attenuated derivative of an L. monocytogenes {Delta}dal {Delta}dat strain (strain DP-L3506 [20]) was made by deletion of the linked actA and plcB genes. Splicing by overlapping extension PCR (10) was used to engineer a PCR product with an in-frame deletion of the coding sequences of these genes, as follows: primers A (5'-GGCTGCAGAGGTAGAACGGGCTGATACCC-3') and B (5'-CCATTCAGAATTTCCTACTAACTACCATCATCGCACGC-3') were used to amplify the upstream flanking region of actA, and primers C (5'-GCGTGCGATGATGGTAGTAGTAGGAAATTCTGAATGG-3') and D (5'-GGCTGCAGCTGATAACGGAATGCTAAGG-3') amplified the downstream flanking region of plcB. The AB and CD fragments were amplified by PCR with L. monocytogenes 10403S DNA as the template (4), and then splicing by overlapping extension PCR was used to generate the final ABCD product. The underlined PstI sites were used to clone the ABCD fragment into the pKSV7 allelic exchange vector (19). The pKSV7{Delta}actA {Delta}plcB construct was introduced into L. monocytogenes {Delta}dal {Delta}dat by electroporation, and allelic exchange was used to generate the L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB strain (strain DP-L4851). The existence of the deletion was confirmed by PCR assays and Southern blot analysis.

Growth and stability of pPL2dalGlnA strains. For the growth assays, individual colonies of each L. monocytogenes strain were inoculated into BHI broth and cultured overnight at 30°C without aeration. One milliliter of each overnight bacterial culture was washed twice in phosphate-buffered saline (PBS), and the optical density at 600 nm (OD600) of the washed bacteria was measured. On the basis of this measurement, the organisms were backdiluted into 20 ml of BHI broth to a concentration of ~2 x 106/ml. The cultures were subsequently grown shaking at 37°C, and the OD600 was measured each hour for 7 h.

For the stability assays, overnight cultures were started from single colonies of each strain, as described above, except that 10403S::pPL2 was grown in BHI broth supplemented with 10 µg/ml chloramphenicol to select for the integrated plasmid. Each culture was backdiluted 1:100 into 10 ml of fresh BHI broth (10403S and 10403S::pPL2) or BHI broth supplemented with 100 µg/ml D-alanine (10403S::pPL2dalGlnA). Backdilutions were repeated at ~12-h intervals for a total of 13 to 18 passages. The OD600 of the final culture was measured and was used to estimate the bacterial numbers in the culture. On the basis of this estimate, volumes equivalent to ~200 CFU were plated onto BHI agar plates and BHI agar plates supplemented with chloramphenicol or D-alanine at the concentrations indicated above. The numbers of CFU recovered from nonselective plates (BHI agar for 10403S::pPL2 or BHI plus D-alanine for 10403S::pPL2dalGlnA) were compared to the number recovered from selective plates to estimate the frequency of pPL2dalGlnA loss.

Animal infections. The competitive index (CI) assay measures the relative abilities of two strains to survive and replicate in the tissues of infected mice. CI values were determined as detailed previously (2), with the exception that output CI values were adjusted to the ratio of the number of test strains input/number of control strains input. The measured input ratios were between 1.1 and 1.4 for all experiments. Briefly, mice were infected intravenously (i.v.) with a total dose of 2 x 105 CFU that was an estimated 1:1 input ratio of strain DP-L3903 and either 10403S::pPL2 or 10403S::pPL2dalGlnA. At 72 h after infection, the mice were killed, their livers were harvested and homogenized in 0.2% Nonidet P-40, and serial dilutions were plated on LB agar without erythromycin (Erm). After growth at 37°C, ~60 individual colonies were patched from these plates onto plates supplemented with 1 µg/ml Erm. The ratios of the Ermr wild-type strain/Erms test strains (10403S::pPL2 and 10403S::ppl2dalGlnA) were then calculated on the basis of the number of patched colonies that grew on LB agar-Erm. This ratio was divided by the input ratio to determine the adjusted CI value for each of the three to five C57BL/6 mice used per experiment.

We also investigated the ability of an L. monocytogenes {Delta}dal {Delta}dat strain complemented with pPL2dalGlnA (L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA) to replicate and persist in the organs of mice after monotypic infection. The bacteria were grown to log phase (OD600, ~0.1) in tryptic soy broth medium supplemented with 100 µg/ml D-alanine and diluted into PBS. C57BL/6 mice were infected with an immunizing dose of wild-type L. monocytogenes strain 10403S (5,000 CFU) or with 104 or 106 CFU of L. monocytogenes {Delta}dal {Delta}dat or L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA. The livers and spleens were harvested at 36 h postinfection (hpi), and serial dilutions of the lysates from these organs were plated on LB agar (strains 10403S and L. monocytogenes {Delta}dal {Delta}dat::dalGlnA) or LB agar plus 100 µg/ml D-alanine (L. monocytogenes {Delta}dal {Delta}dat) to enumerate the bacterial burdens.

Cloning of SIV Nef and HIV Tat into pPL2dalGlnA. An antigen expression cassette was made by cloning FLAG-tagged simian immunodeficiency virus (SIV) Nef (deleted of its first 11 amino acids) and vesicular stomatitis virus (VSV)-tagged HIV Tat downstream of DNA containing the L. monocytogenes actA and hly promoter signal sequences, respectively, in pUC19. The KpnI-PstI fragment encoding these genes was then subcloned into pPL2dalGlnA and electroporated into the E. coli strains from which glnA was deleted. Recombinant colonies were selected on nutrient broth agar without glutamine and identified by PCR analysis. Plasmid DNA (~3 µg) from a positive clone was electroporated into the {Delta}actA-plcB derivative of L. monocytogenes {Delta}dal {Delta}dat described above to generate the recombinant vaccine strain, L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat.

Immunoblots. The recombinant L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat strain and the control L. monocytogenes {Delta}dal {Delta}dat strain were grown in BHI broth (supplemented with D-alanine for L. monocytogenes {Delta}dal {Delta}dat) at 30°C overnight. The overnight cultures were diluted 1:20 and grown at 36°C for 4 h. After centrifugation, the proteins in the supernatant fractions of these cultures were precipitated with trichloroacetic acid (TCA). The TCA-precipitated proteins from 1 ml of supernatant were dissolved in sample buffer (62.5 mM Tris-Cl, pH 6.8, 2% sodium dodecyl sulfate, 10% glycerol, 5% β-mercaptoethanol, 0.1% bromophenol blue) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The proteins were transferred to nitrocellulose membranes, blocked in Blotto buffer (1% Tween 20, 5% nonfat milk in PBS) for 2 h, incubated with a primary anti-tag antibody (anti-VSV antibody for Tat protein and anti-FLAG antibody for Nef protein) at 4°C overnight and then with horseradish peroxidase-labeled immunoglobulin G for 1 h at room temperature, and detected with an enhanced chemiluminescence Western blotting analysis system and by exposure to film.

Immunization and ELISPOT assay. For the mouse immunizations, 6- to 8-week-old female BALB/c mice were inoculated i.v. with 2 x 107 CFU of the L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat strain. After 10 days, splenocyte suspensions were prepared by pressing the tissue through a nylon mesh screen, followed by lysis of red blood cells with ACK lysis buffer (Invitrogen). Ninety-six-well enzyme-linked immunospot (ELISPOT) assay plates (Millipore, Bedford, MA) were coated with anti-mouse gamma interferon (IFN-{gamma}) capture antibody (1:60 in PBS; R&D Systems) and incubated overnight at 4°C. On the second day, the plates were washed and blocked for 2 h with RPMI 1640 containing 10% fetal bovine serum (Genimi BioProducts) and 1% of a 10,000-U/ml penicillin-streptomycin solution. Suspensions containing 5 x 105 splenocytes in RPMI 1640 were added to each well and were stimulated in duplicate, with or without 25 µg/ml of a complete set of HIV type 1 clade B Tat synthetic 15-amino-acid-long peptides, each of which overlapped by 11 amino acids (AIDS Research and Reference Reagent Program), or 25 µg/ml of concanavalin A (Sigma Chemical Co.). After incubation at 37°C in a 5% CO2 incubator for 24 h, the plate was washed and incubated with biotinylated anti-mouse IFN-{gamma} detection antibody (1:60 in 1% bovine serum albumin; R&D Systems) and incubated overnight at 4°C. The wells were then incubated with streptavidin-conjugated alkaline phosphatase (1:60 in 1% bovine serum albumin) for 2 h at room temperature, washed with PBS, and incubated with 5-bromo-4-chloro-3-indolyl phosphate substrate to develop the color. The spots were counted with an automated ELISPOT reader (Cellular Technology, Ltd., Shaker Heights, OH).


arrow
RESULTS AND DISCUSSION
 
Engineering of pPL2dalGlnA. L. monocytogenes strains that retain the ability to invade and replicate in the host cell cytosol also retain immunogenicity and are showing promise as vaccine delivery vehicles (5). D-Alanine is an essential component of bacterial peptidoglycan and is also incorporated into teichoic acids. In L. monocytogenes, D-alanine is produced from L-alanine by an alanine racemase (Dal) and from D-glutamic acid plus pyruvate by a D-amino acid transferase (Dat). L. monocytogenes strains from which both dal and dat are deleted ({Delta}dal {Delta}dat strains) thus require exogenous D-alanine for continued replication. Furthermore, since only trace quantities of D-alanine are produced by mammals, the replication of L. monocytogenes {Delta}dal {Delta}dat is truncated in infected cells or mice (20). However, L. monocytogenes {Delta}dal {Delta}dat strains retain the ability to access the host cell cytosol and were shown to generate CD8+ T-cell responses to L. monocytogenes antigens (20). Given previous work that showed the utility of the dal gene as a selectable marker for the maintenance of plasmids in a D-alanine-auxotrophic Bacillus subtilis strain (7), we reasoned that dal might similarly be used for selection of the pPL2 integrational vector in L. monocytogenes {Delta}dal {Delta}dat. We thus first replaced the gram-positive bacterial chloramphenicol resistance (cat) gene with the L. monocytogenes dal gene to create pPL2dal (Fig. 1A). pPL2dal was then mated into an L. monocytogenes {Delta}dal {Delta}dat strain and selected for growth on BHI agar plates lacking D-alanine supplementation. Several colonies were obtained and were shown by PCR to have integrated pPL2dal into the appropriate tRNAArg locus (data not shown). These data confirmed the utility of dal as a selectable marker for use in L. monocytogenes {Delta}dal {Delta}dat strains.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 1. Maps of plasmid vectors pPL2dal (A) and pPL2dalGlnA (B) engineered in this study. Both plasmids were derived from the pPL2 vector (13), which can be integrated in a single step into the chromosome of L. monocytogenes. The plasmids were continually selected in appropriate auxotrophic E. coli {Delta}glnA and L. monocytogenes {Delta}dal {Delta}dat strains. pPL2dal retains an antibiotic resistance marker for chloramphenicol resistance (cat) in gram-negative bacteria, while pPL2dalGlnA lacks all antibiotic resistance markers.

We next sought to replace the gram-negative bacterial antibiotic resistance marker (cat) used for the maintenance of pPL2dal in E. coli. We also considered using dal for selection in E. coli strains that require D-alanine due to flp recombinase-mediated disruption of the alanine racemase and D-amino acid dehydrogenase (alr::frt dadX::frt). However, such strains give rise to pseudorevertants on medium not supplemented with D-alanine, which may complicate the engineering of antigen-expressing plasmids. Therefore, we instead replaced the gram-negative bacterial cat gene with the E. coli gene for glutamine synthetase (glnA) to generate plasmid pPL2dalGlnA (Fig. 1B). The resulting pPL2dalGlnA vector entirely lacks antibiotic resistance genes but retains a replication origin for gram-negative bacteria (p15A ori), an origin of transfer for mating (oriT from the conjugative plasmid RP4), a multicloning site, and the integrase gene (int) and phage attachment site (attP) from phage PSA. We next engineered glutamine-auxotophic E. coli strains by deleting glutamine synthetase and its promoter from E. coli SURE and MG1655. These {Delta}glnA strains failed to grow on autoclaved nutrient broth, which is deficient in glutamine (3). However, transformation of either strain with pPL2dalGlnA restored their growth on glutamine-free medium, confirming that this system can be used to engineer antigen expression cassettes in pPL2dalGlnA.

Stability of pPL2dalGlnA integration in L. monocytogenes {Delta}dal {Delta}dat. Similar to pPL2dal, pPL2dalGlnA restored the ability of L. monocytogenes {Delta}dal {Delta}dat to grow on selective (D-alanine-deficient) medium. To determine the stability of pPL2dlaGlnA integration in the absence of selective pressure, we repeatedly passaged the complemented L. monocytogenes {Delta}dal {Delta}dat strain under nonselective conditions. When colonies were plated after 13 to 18 serial passages in the absence of selective pressure, 96 to 100% of the colonies recovered on nonselective BHI agar plates (supplemented with D-alanine) were also recovered on selective (nonsupplemented) BHI agar plates. These data are consistent with previously published data on the stability of pPL2 integration (13) and indicate that the integrated pPL2dalGlnA vector is highly stable even in the absence of selection.

pPL2dalGlnA only partially complements the virulence of L. monocytogenes {Delta}dal {Delta}dat. To evaluate the effects of pPL2dalGlnA on the growth and virulence of the L. monocytogenes strains, we first compared the growth rate of an L. monocytogenes {Delta}dal {Delta}dat strain with integrated pPL2dalGlnA (L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA) to that of wild-type L. monocytogenes parental strain 10403S and a pPL2 integrant of 10403S (Fig. 2A). Equal numbers of each bacterial strain were diluted in parallel from overnight cultures into nonsupplemented BHI broth, and the growth of the respective strains was measured by hourly readings of the OD from each culture. As shown in Fig. 2, the growth rates of the three bacterial strains were identical. In the absence of pdPL2dalGlnA or medium supplemented with D-alanine, L. monocytogenes {Delta}dal {Delta}dat showed no growth at all (data not shown). Thus, these data suggest that the expression of alanine racemase from the integrated pPL2dalGlnA vector fully complements the growth of L. monocytogenes {Delta}dal {Delta}dat in culture. We thus next used a CI assay to quantify the effects of pPL2dalGlnA integration on bacterial growth in infected C57BL/6 mice. For these experiments, groups of three to five mice each were infected with equal ratios of the pPL2 integrant or the pPL2dalGlnA integrant and a wild-type Erm-resistant L. monocytogenes 10403S strain (strain DP-L3903). At 72 h after i.v. infection, homogenates of tissues were harvested from the infected mice and plated on BHI broth alone or BHI broth supplemented with 1 µg/ml Erm. On the basis of the colony counts, the ratios of the CI of the Erm-sensitive strain (the pPL2 integrant of strain 10403S or L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA) to the CI of the Erm-resistant strain (10403S) from the liver of each mouse were determined (Fig. 2B). In two of two experiments, the pPL2 integrant of 10403S showed only a slight competitive disadvantage (mean CI ratio, ~0.5) relative to that of wild-type strain 10403S. In contrast, the L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA strain showed a more substantial reduction in its ability to compete for growth in vivo (mean CI ratio, ~0.01). These data suggest that alanine racemace is not sufficient for full complementation of the growth of L. monocytogenes {Delta}dal {Delta}dat during whole-animal infection, and that the dat deletion restricts the growth of these bacteria. In addition, one may speculate that the L-alanine substrate for alanine racemase may be limiting at sites of L. monocytogenes replication in infected mice.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 2. Integration of pPL2dalGlnA partially complements the virulence of L. monocytogenes {Delta}dal {Delta}dat (Lmdd). (A) Growth of wild-type (wt) L. monocytogenes 10403S, 10403S transduced with pPL2 (10403S::pPL2), and L. monocytogenes {Delta}dal {Delta}dat transduced with pPL2dalGlnA (10403S::pPL2dalGlnA) in broth culture. L. monocytogenes {Delta}dal {Delta}dat alone is unable to grow in this medium (data not shown). The OD600s of the cultures were measured at each of the indicated times after inoculation of BHI broth. (B) CI ratios calculated with L. monocytogenes isolates from the livers of individual infected C57BL/6 mice at 72 h after infection. The CI ratios reflect the relative in vivo fitness of the Erm-sensitive pPL2 or pPL2dalGlnA test strains following coinfection with a control Erm-resistant L. monocytogenes wild-type strain (strain DP-L3903). Thus, coinfection with strains with equivalent virulence yields a CI value of 1. Circles and triangles, the ratios for isolates recovered from individual mice; bars, mean CI values for each group. The means were significantly different (P < 0.001), as judged by the t test. Between 2 x 104 and 2 x 105 total numbers of CFU were recovered from each organ at this time point.

It is known that L. monocytogenes must persist in the tissues of infected mice for over 24 h in order to generate robust protective T-cell responses (14). We thus also determined whether the attenuated L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA strain was capable of persisting for >24 h after monotypic infection of C57BL/6 mice. The results of this experiment are shown in Table 1. In mice given doses containing as many as 106 L. monocytogenes {Delta}dal {Delta}dat bacteria, we failed to recover any CFU from infected spleens and livers by 36 hpi. Conversely, when the mice were given the L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA strain, bacteria were still recovered from the tissues of infected mice at this time point. With the low-dose infection (104 CFU), the rate of recovery of L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA bacteria was ~20- to 250-fold less than that seen with low-dose infection with wild-type strain 10403S. However, when the mice were inoculated with a higher dose of L. monocytogenes {Delta}dal {Delta}dat::pPL2dalGlnA (106 CFU), bacteria were recovered in numbers only two- to fourfold lower than the numbers of wild-type strain 10403S recovered. These data indicate that the stable integration of pPL2dalGlnA into the chromosome of L. monocytogenes {Delta}dal {Delta}dat restores the ability to establish infection of mouse tissues that persists beyond 24 hpi. These data further suggest that pPL2dalGlnA-based antigen expression constructs engineered in L. monocytogenes {Delta}dal {Delta}dat strains should adequately restore colonization to immunize protective T-cell responses.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Transformation of L. monocytogenes {Delta}dal {Delta}dat with pPL2dalGlnA restores its ability to persist during monotypic infection of micea

An attenuated L. monocytogenes vaccine strain for use with pPL2dalGlnA. The results presented above clearly indicate that the expression of dal is not sufficient to fully complement the virulence of L. monocytogenes {Delta}dal {Delta}dat in healthy mice. However, growth of the complemented strain was reduced by only ~100-fold. We thus sought to generate a more highly attenuated vaccine strain. L. monocytogenes mutants that individually lacked the actA or the plcB virulence gene are defective for bacterial cell-cell spread and had ~10,000-fold and 100-fold reduced growth, respectively, by the CI assay (11, 18). In addition, the attenuated L. monocytogenes 10403S from which the actA and plcB genes were deleted has also been studied in a phase I dose escalation safety study of oral delivery with 20 healthy human volunteers (1). Doses up to 109 CFU were well tolerated. In the previous study, there were no serious adverse events from systemic infection, suggesting that attenuated L. monocytogenes {Delta}actA-plcB is a reasonable strain for use as a start in the engineering of a human vaccine vector. Thus, to generate a more highly attenuated strain for use with pPL2dalGlnA-based vaccines, we deleted both of these linked pathogenicity genes from an L. monocytogenes {Delta}dal {Delta}dat strain. The resulting strain is defined as L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB.

Antigen expression and immunization with pPL2dalGlnA. To demonstrate the usefulness of pPL2dalGlnA and L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB for the expression and delivery of foreign antigens, we engineered constructs for the expression of the SIV Nef and the HIV Tat antigens (Fig. 3A). Genes for these antigens were cloned downstream of DNA containing the L. monocytogenes actA and hly promoters, respectively, and introduced into L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB. Culture supernatants from L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB transformants contained both the Nef and the Tat proteins (Fig. 3B), as detected by immunoblotting. When it was used to immunize BALB/c mice, the recombinant L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat strain elicited a clear response to the set of HIV type 1 Tat peptides (Fig. 3C). An IFN-{gamma} ELISPOT assay revealed that ~1/10,000 splenocytes responded to the Tat peptide at 10 days after immunization (Fig. 3C). Thus, we conclude that the pPL2dalGlnA vector system will be useful for the generation of safe vaccine strains of L. monocytogenes by use of the novel strain L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB or other derivatives of L. monocytogenes {Delta}dal {Delta}dat.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 3. T-cell response to exogenous antigens expressed from pPL2dalGlnA in a highly attenuated L. monocytogenes strain. (A) Diagram of the SIV Nef and HIV Tat antigen expression cassette cloned into pPL2dalGlnA and integrated in L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB (Lmdd{Delta}AB). (B) Western blots showing FLAG-tagged Nef and VSV epitope-tagged Tat proteins in supernatants of the recombinant L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat strain. Shown are immunoblots of proteins precipitated with TCA from the supernatant of L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat strain (lanes 1 and 3) or a control L. monocytogenes {Delta}dal {Delta}dat strain (lanes 2 and 4) probed with anti-FLAG tag or anti-VSV tag antibodies. (C) Frequency of IFN-{gamma}-secreting cells responding to overlapping HIV Tat peptides. Shown are the mean number of responding IFN-{gamma}-positive spleoncytes detected by the ELISPOT assay 10 days after the immunization of mice with L. monocytogenes {Delta}dal {Delta}dat {Delta}actA-plcB Nef Tat. The results of the experiments shown are representative of those of at least two additional studies.

In conclusion, we have developed a novel genetic system for the stable expression of recombinant antigens from attenuated L. monocytogenes in the absence of antibiotic resistance genes. We believe that our system is an improvement over that of Verch et al., who recently used dal to maintain plasmids in auxotrophic D-alanine-requiring E. coli and L. monocytogenes bacterial strains (21). Our novel system is instead based on modifications of the integrational vector pPL2. Like the parental pPL2 vector, pPL2dalGlnA is stably maintained in L. monocytogenes even without selection. In addition, given the paucity of D-alanine in mammalian tissues, pPL2dalGlnA should be positively selected to maintain antigen expression during immunization regimens. The development of safe, attenuated L. monocytogenes strains that express recombinant antigens in the absence of antibiotic resistance represents a major step toward the application of the L. monocytogenes antigen expression methodology for the vaccination of humans.


arrow
ACKNOWLEDGMENTS
 
We thank Sydney Kustu for suggesting the selection for glnA on nutrient broth; John Beaber for assistance with the deletion of glnA; Andrew Phillips for assistance with the stability and growth assays; and Daniel Portnoy, Fred Frankel, and Libby Hohmann for support and encouragement. We thank the AIDS Research and Reference Reagent Program for reagents.

This work was supported by NIH grants AI065638 (to L.L.L.), AI51206 (to Elizabeth Hohmann), and AI054558 (to Fred R. Frankel).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Integrated Department of Immunology, National Jewish Medical and Research Center, 1400 Jackson Street, Rm. K510, Denver, CO 80206. Phone: (303) 398-1767. Fax: (303) 398-1396. E-mail: lenzl{at}njc.org Back

{triangledown} Published ahead of print on 23 July 2008. Back


arrow
REFERENCES
 
    1
  1. Angelakopoulos, H., K. Loock, D. M. Sisul, E. R. Jensen, J. F. Miller, and E. L. Hohmann. 2002. Safety and shedding of an attenuated strain of Listeria monocytogenes with a deletion of actA/plcB in adult volunteers: a dose escalation study of oral inoculation. Infect. Immun. 70:3592-3601.[Abstract/Free Full Text]
    2. 2
  2. Auerbuch, V., L. L. Lenz, and D. A. Portnoy. 2001. Development of a competitive index assay to evaluate the virulence of Listeria monocytogenes actA mutants during primary and secondary infection of mice. Infect. Immun. 69:5953-5957.[Abstract/Free Full Text]
    3. 3
  3. Bancroft, S., S. G. Rhee, C. Neumann, and S. Kustu. 1978. Mutations that alter the covalent modification of glutamine synthetase in Salmonella typhimurium. J. Bacteriol. 134:1046-1055.[Abstract/Free Full Text]
    4. 4
  4. Bishop, D. K., and D. J. Hinrichs. 1987. Adoptive transfer of immunity to Listeria monocytogenes. The influence of in vitro stimulation on lymphocyte subset requirements. J. Immunol. 139:2005-2009.[Abstract]
    5. 5
  5. Brockstedt, D. G., M. A. Giedlin, M. L. Leong, K. S. Bahjat, Y. Gao, W. Luckett, W. Liu, D. N. Cook, D. A. Portnoy, and T. W. Dubensky, Jr. 2004. Listeria-based cancer vaccines that segregate immunogenicity from toxicity. Proc. Natl. Acad. Sci. USA 101:13832-13837.[Abstract/Free Full Text]
    6. 6
  6. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.[Abstract/Free Full Text]
    7. 7
  7. Ferrari, E., D. J. Henner, and M. Y. Yang. 1985. Isolation of an alanine racemase gene from Bacillus subtilis and its use for plasmid maintenance in B. subtilis. Biotechnology 3:1003-1007.[CrossRef]
    8. 8
  8. Frankel, F. R., S. Hegde, J. Lieberman, and Y. Paterson. 1995. Induction of cell-mediated immune responses to human immunodeficiency virus type 1 Gag protein by using Listeria monocytogenes as a live vaccine vector. J. Immunol. 155:4775-4782.[Abstract]
    9. 9
  9. Goossens, P. L., G. Milon, P. Cossart, and M. F. Saron. 1995. Attenuated Listeria monocytogenes as a live vector for induction of CD8+ T cells in vivo: a study with the nucleoprotein of the lymphocytic choriomeningitis virus. Int. Immunol. 7:797-805.[Abstract/Free Full Text]
    10. 10
  10. Horton, R. M., Z. L. Cai, S. N. Ho, and L. R. Pease. 1990. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques 8:528-535.[Medline]
    11. 11
  11. Humann, J., R. Bjordahl, K. Andreasen, and L. L. Lenz. 2007. Expression of the p60 autolysin enhances NK cell activation and is required for Listeria monocytogenes expansion in IFN-{gamma}-responsive mice. J. Immunol. 178:2407-2414.[Abstract/Free Full Text]
    12. 12
  12. Ikonomidis, G., Y. Paterson, F. J. Kos, and D. A. Portnoy. 1994. Delivery of a viral antigen to the class I processing and presentation pathway by Listeria monocytogenes. J. Exp. Med. 180:2209-2218.[Abstract/Free Full Text]
    13. 13
  13. Lauer, P., M. Y. Chow, M. J. Loessner, D. A. Portnoy, and R. Calendar. 2002. Construction, characterization, and use of two Listeria monocytogenes site-specific phage integration vectors. J. Bacteriol. 184:4177-4186.[Abstract/Free Full Text]
    14. 14
  14. Mercado, R., S. Vijh, S. E. Allen, K. Kerksiek, I. M. Pilip, and E. G. Pamer. 2000. Early programming of T cell populations responding to bacterial infection. J. Immunol. 165:6833-6839.[Abstract/Free Full Text]
    15. 15
  15. Pamer, E. G. 2004. Immune responses to Listeria monocytogenes. Nat. Rev. Immunol. 4:812-823.[CrossRef][Medline]
    16. 16
  16. Pan, Z. K., G. Ikonomidis, A. Lazenby, D. Pardoll, and Y. Paterson. 1995. A recombinant Listeria monocytogenes vaccine expressing a model tumour antigen protects mice against lethal tumour cell challenge and causes regression of established tumours. Nat. Med. 1:471-477.[CrossRef][Medline]
    17. 17
  17. Shen, H., M. K. Slifka, M. Matloubian, E. R. Jensen, R. Ahmed, and J. F. Miller. 1995. Recombinant Listeria monocytogenes as a live vaccine vehicle for the induction of protective anti-viral cell-mediated immunity. Proc. Natl. Acad. Sci. USA 92:3987-3991.[Abstract/Free Full Text]
    18. 18
  18. Smith, G. A., H. Marquis, S. Jones, N. C. Johnston, D. A. Portnoy, and H. Goldfine. 1995. The two distinct phospholipases C of Listeria monocytogenes have overlapping roles in escape from a vacuole and cell-to-cell spread. Infect. Immun. 63:4231-4237.[Abstract/Free Full Text]
    19. 19
  19. Smith, K., and P. Youngman. 1992. Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74:705-711.[CrossRef][Medline]
    20. 20
  20. Thompson, R. J., H. G. Bouwer, D. A. Portnoy, and F. R. Frankel. 1998. Pathogenicity and immunogenicity of a Listeria monocytogenes strain that requires D-alanine for growth. Infect. Immun. 66:3552-3561.[Abstract/Free Full Text]
    21. 21
  21. Verch, T., Z. K. Pan, and Y. Paterson. 2004. Listeria monocytogenes-based antibiotic resistance gene-free antigen delivery system applicable to other bacterial vectors and DNA vaccines. Infect. Immun. 72:6418-6425.[Abstract/Free Full Text]

Clinical and Vaccine Immunology, September 2008, p. 1414-1419, Vol. 15, No. 9
1071-412X/08/$08.00+0     doi:10.1128/CVI.00208-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lenz, L. L.
Right arrow Articles by Calendar, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lenz, L. L.
Right arrow Articles by Calendar, R.

Copyright © 2010 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»