This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Datta, K.
Right arrow Articles by Pirofski, L.-a.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Datta, K.
Right arrow Articles by Pirofski, L.-a.

 Previous Article  |  Next Article 

Clinical and Vaccine Immunology, August 2008, p. 1176-1187, Vol. 15, No. 8
1071-412X/08/$08.00+0     doi:10.1128/CVI.00130-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Therapeutic Efficacy of a Conjugate Vaccine Containing a Peptide Mimotope of Cryptococcal Capsular Polysaccharide Glucuronoxylomannan{triangledown}

Kausik Datta,1,{dagger} Andrew Lees,2,{ddagger} and Liise-anne Pirofski1,3*

Department of Microbiology and Immunology,1 Department of Medicine, Albert Einstein College of Medicine, Bronx, New York 10461,3 Biosynexus Inc., 9119 Gaither Road, Gaithersburg, Maryland 208772

Received 12 April 2008/ Returned for modification 8 May 2008/ Accepted 27 May 2008


arrow
ABSTRACT
 
Vaccination with P13, a peptide mimotope of the cryptococcal capsular polysaccharide glucuronoxylomannan (GXM), has been shown to confer protection against a subsequent lethal Cryptococcus neoformans challenge. In this study, we sought to investigate whether P13-based vaccines could be effective in an already-established infection. To address this question, we developed a systemic chronic cryptococcal infection model. We vaccinated chronically infected mice with P13-protein conjugates and monitored their survival. Compared to the controls, the conjugates prolonged the survival of chronically infected mice. The degree of protection was a function of the mouse strain (BALB/c or C57BL/6), the carrier protein (tetanus toxoid or diphtheria toxoid), and the route of infection (intraperitoneal or intravenous). Serum GXM levels were correlated with the day of death, but the correlation was driven by the carrier protein and mouse strain. The passive transfer of heat-treated sera from P13 conjugate-vaccinated mice conferred protection to naïve BALB/c mice, indicating that antibody immunity could contribute to protection. The measurement of peripheral blood cytokine (gamma interferon [IFN-{gamma}], interleukin-10 [IL-10], and IL-6) gene expression showed that P13 conjugate-vaccinated BALB/c and C57BL/6 mice mounted a strong Th2 (IL-10)-like response relative to the Th1 (IFN-{gamma})-like response, with the degree depending on the mouse strain and carrier protein. Taken together, our data suggest that a vaccine could hold promise in the setting of chronic cryptococcosis, and that vaccine efficacy could depend on immunomodulation and augmentation of the natural immune response of the host.


arrow
INTRODUCTION
 
Cryptococcus neoformans is a fungal pathogen with a world-wide distribution (50). Although it is ubiquitous in the environment and primary C. neoformans infection is acquired in childhood (1, 26, 61), cryptococcal disease (cryptococcosis) occurs predominantly in immunocompromised hosts (10), such as patients with AIDS (64) or hematological malignancies (49, 56), patients receiving chemotherapy for malignancy (45) or immunosuppressive agents for organ transplantation (29, 63), and those with underlying metabolic disorders (14, 32). Recently, it has come to light that, in addition to occurring in the setting of immunosuppression, cryptococcosis also can stem from an exuberant immune response (11, 19), such as that seen after immune reconstitution in AIDS patients on antiretroviral therapy (30) and in solid-organ transplant recipients (59). Cryptococcosis also can occur in apparently immunocompetent individuals (4), although they also may have subtle but unidentified immune defects (43).

C. neoformans infection may manifest as a pulmonary or cutaneous disease, but the most devastating and common complication is meningoencephalitis. Cryptococcal meningoencephalitis is difficult to treat despite the availability of antifungal agents that are active against C. neoformans in vitro, because these agents often cannot eradicate the organism in the setting of immune suppression (52). Given that the development of cryptococcosis is largely attributable to host immune impairment, approaches to disease prevention that are focused on augmenting host immune mechanisms against C. neoformans are a logical adjunct to antifungal agents. In this regard, a cryptococcal vaccine makes sense, with the caveat that many instances of cryptococcal disease are thought to reflect the reactivation of latent infection (25, 61). Therefore, a vaccine for C. neoformans would have to be effective in the setting of latent or previous infection.

The rationale for a vaccine for C. neoformans that elicits antibodies to the capsular polysaccharide glucuronoxylomannan (GXM) is based on the ability of such antibodies to augment the host response to experimental cryptococcosis to the benefit of the host (19). The efficacy of a conjugate consisting of a decapeptide mimotope (P13) of GXM and a carrier protein in prolonging the survival of mice after a lethal challenge with C. neoformans has been demonstrated previously (24, 51, 67). Vaccine-mediated protection in these models was associated with a reduction in the levels of serum GXM and the production of antibodies to GXM that were shown to prolong the survival of naïve mice with C. neoformans infection (24, 41, 42). To determine the effect of P13-protein conjugate vaccines in the setting of an already-established infection, we developed a model in which mice that had been infected with C. neoformans were vaccinated and monitored to determine the effect of vaccination on the course of infection.


arrow
MATERIALS AND METHODS
 
Mouse strains. Six- to 8-week-old BALB/c and C57BL/6 mice were obtained from the National Cancer Institute (Bethesda, MD) and maintained in the Institute for Animal Studies of the Albert Einstein College of Medicine (AECOM). All mouse experiments were conducted with prior approval from the Animal Institute Committee of AECOM by following established guidelines.

Establishment of chronic infection. All infection studies described herein used a serotype D strain of C. neoformans (ATCC 24067; henceforth referred to as CN24067; American Type Culture Collection, Manassas, VA). This strain has been used extensively to evaluate the effect of antibody immunity to C. neoformans (15, 18, 23, 40, 42, 47). The organism was grown for 52 to 56 h at 37°C with shaking in Difco Sabouraud's dextrose broth (Becton Dickinson and Co., Franklin Lakes, NJ), washed twice in sterile, endotoxin-free phosphate-buffered saline (PBS), pH 7.4 (Mediatech, Inc., Herndon, VA), counted in a hemocytometer using trypan blue for viability, and diluted to the desired concentration in PBS. Mice were infected intraperitoneally (i.p.) with 3 x 104 CFU of CN24067 per mouse, a low dose previously determined to be nonlethal for <90 days in BALB/c and C57BL/6 mice (data not shown). The mice were bled on days 7 and 20 postinfection, and the serum GXM concentration was assayed (described below). Mice were bled retroorbitally with prior inhalational anesthesia using isoflurane (3 to 4% in oxygen at a 2-liter/m flow). The serially collected serum GXM levels were used to establish the degree of infection in each individual mouse prior to immunization. In the intravenous (i.v.) infection model of BALB/c mice, 200 CFU of CN24067 per mouse was administered in the lateral tail vain using a restrainer (Braintree Scientific, Inc., Braintree, MA). All inocula were confirmed by being plated on BBL Sabouraud's dextrose agar plates (Beckton Dickinson) immediately after infection.

Precipitation and purification of GXM. The polysaccharide GXM was purified from CN24067 following a modification of the original method described by Cherniak et al. (16). Briefly, the organism was grown at 30°C for 7 to 10 days in 100 ml of Sabouraud's dextrose broth, and the cells were removed by centrifugation (1,800 x g for 15 min). Powdered sodium acetate (Sigma) was added slowly to the supernatant to 10% (wt/vol) with stirring, the pH was quickly adjusted to 7 using glacial acetic acid, and the capsular polysaccharide was precipitated by the slow addition of 2.5 volumes of 95 to 100% ethanol, followed by incubation for 72 h at 4°C. The crude polysaccharide precipitate was collected, dissolved in 15 to 20 ml of distilled water, and quantified using a micromodification of the phenol-sulfuric acid method of Dubois et al. (22) and a novel standard containing D-glucuronic acid, D-xylose, and mannose (all from Sigma) in a molar ratio of 1:1:3 (the same as that described for serotype D GXM [7]). The crude polysaccharide preparation was adjusted to 0.2 M sodium chloride, and the GXM was separated by the addition, with stirring, of a precalculated volume of hexadecyltrimethyl-ammonium bromide (CTAB; 0.3% in water; Sigma), containing CTAB at three times the estimated amount of total polysaccharide (wt/wt) to yield a complex containing CTAB bound to GXM. The CTAB-GXM complex was precipitated at 10,000 x g for 30 min at 23°C, washed with 10% ethanol, allowed to settle out of solution, repelleted, and dissolved in 1 M sodium chloride by being stirred overnight at room temperature. The GXM component was selectively reprecipitated (leaving CTAB in the sodium chloride phase) by the slow addition of 2 volumes of 95% ethanol; the precipitate was pelleted again by centrifugation, dissolved in 2 M sodium chloride, dialyzed extensively (with a 10-kDa cutoff tubing) against 1 M sodium chloride, and redialyzed against water to remove the salt before lyophilization. The lyophilized, pure GXM material was weighed and dissolved appropriately in water, and its antigenicity was confirmed by enzyme-linked immunosorbent assay (ELISA).

Estimation of serum GXM concentration. The GXM concentrations in individual serum samples from chronically infected mice were determined by an antigen capture ELISA, using a previously described protocol (24). Briefly, 96-well microtiter plates were coated for 1 h at 37°C with a human immunoglobulin M (IgM) monoclonal antibody to GXM (G19; described previously [40]) at 5 µg/ml of PBS (pH 7.4) and blocked overnight with 1% bovine serum albumin in PBS. Prior to the assay, serum samples were diluted 1:100 in PBS, incubated with 200 µg of proteinase K (Sigma Chemical Co., St. Louis, MO) per ml for 4 h, and then boiled for 30 min in a water bath to inactivate the proteinase K. Purified GXM from CN24067 was diluted to 10 µg/ml in PBS and similarly treated. Next, the plates were washed, incubated with threefold serial dilutions of GXM (starting at 10 µg/ml; to generate a standard curve) or serum samples (starting at 1:100), washed again, and reincubated with 5 µg/ml of a mouse IgG1 monoclonal antibody to GXM (2H1; provided by A. Casadevall, AECOM). Bound 2H1 was detected by incubating the plates with a 1:5,000 dilution of alkaline phosphatase-conjugated goat anti-mouse IgG1 (Southern Biotechnology, Birmingham, AL). All washes were done three times with PBS containing 0.05% Tween 20 (Fisher Scientific, Fairlawn, NJ) using a SkanWasher 400 automatic 96-well microplate washer (Molecular Devices, Sunnyvale, CA); all incubations were at 37°C for 1 h. The plates were developed for 1 h using 1 mg/ml p-nitrophenyl phosphate substrate (Sigma, St. Louis, MO) and read at 405 nm using a Sunrise spectrophotometer (Tecan Austria GmbH, Grödig, Austria). The standard curve was generated from the absorbance values of the standard dilutions using nonlinear regression and a sigmoidal equation with a variable slope (GraphPad Prism for Windows, version 5.01; GraphPad Software, San Diego, CA), and the GXM concentrations in test samples were extrapolated from the regression curve.

Vaccine preparation, vaccination, and sample collection. Tetanus toxoid (TT) was obtained from the University of Massachusetts Biologic Laboratories, Worcester, and diphtheria toxoid (DT) was obtained from Sigma. P13 conjugates consisting of P13 conjugated to TT (P13TT) and to DT (P13DT) were synthesized by a process involving a thioether linkage, as previously described (24). The mice were divided into groups of similar mean serum GXM concentrations based on day-20 values. Following the protocol previously established in the laboratory (24, 41), mice were vaccinated subcutaneously (at the base of the tail) with 10 µg per mouse of either P13DT or P13TT or, as the respective control, DT or TT, along with Alhydrogel (50 µl per mouse; Accurate Chemical and Scientific Corp., Westbury, NY) prepared in 0.85% saline. Mice were revaccinated on day 26 (first experiment) or at 3 weeks (subsequent repeats) after vaccination. Serum samples were collected at a postvaccination (PV) time point (day 18 for the first experiment, and 24 h, 72 h, and days 7 and 15 for repeats) and one or two postrevaccination time points (days 34 and 84 PV for the first experiment; days 21 and 31 PV for repeats), and the serum GXM concentration was assayed as described above. In the i.v. acute low-inoculum infection model, mice were vaccinated (or given corresponding controls) only once at day 3 following infection.

Passive protection experiments. Sera collected from chronically infected, vaccinated BALB/c mice at day 10 PV (day 14 postinfection) were pooled for each group, heat inactivated at 56°C for 30 min, diluted 1:10 in sterile PBS, and administered i.p. to naïve BALB/c mice 4 h prior to lethal i.v. challenge with 5 x 104 CN24067. Mice were observed daily, and survivals were recorded.

Quantitative real-time PCR. Quantitative real-time PCR was performed to determine the levels of gamma interferon (IFN-{gamma}), interleukin-6 (IL-6), and IL-10 mRNA expression in peripheral blood cells, using the Bio-Rad Laboratories iCycler IQ real-time PCR detection system (Bio-Rad, Hercules, CA). Mice were bled retroorbitally under anesthesia as described above, and 100 µl of blood was diluted with the same volume of UltraPure DNase/RNase-free distilled water (Invitrogen, Carlsbad, CA), placed in 600 µl of TRIzol LS (Invitrogen), and frozen at –80°C for storage; prior to use, samples were thawed at room temperature (15 to 30°C) and left at room temperature for 5 min to permit the complete dissociation of nucleoprotein complexes. RNA was extracted by following the TRIzol LS protocol according to the manufacturer's instructions. The purity of the RNA was estimated by measuring the ratio of absorbances at 260 and 280 nm, and the samples with ratios ≥1.8 were accepted for processing. For cDNA synthesis, 1 µg of sample RNA or standard RNA (mouse spleen RNA; Ambion, Austin, TX) was reverse transcribed using an iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer's instructions. The cytokine primers used for the PCR were chosen from ones previously used in the laboratory (9) (all 5' to 3'): IFN-{gamma} forward, CCTGCGGCCTAGCTCTGA; IFN-{gamma} reverse, CAGCCAGAAACAGCCATGAG; IL-6 forward, ACAACCACGGCCTTCCCTACTT; IL-6 reverse, CACGATTTCACAACCACGGCCTTCCCTACTT; IL-10 forward, CTTGCACTACCAAAGCCACA; IL-10 reverse, TAAGAGCAGGCAGCATAGCA; glyceraldehyde 3-phosphate dehydrogenase (GAPDH; a housekeeping gene for expression normalization) forward, CATCGCCTTCCGTGTTCCTA; GAPDH reverse, GCGGCACGTCAGATCCA. PCR amplification was performed with IQ Sybr green Supermix (Bio-Rad) at 95°C for 5 min and 45 cycles of 95°C for 15 s, followed by 62°C for 45 s for all mRNAs. A standard curve was generated by plotting threshold cycle values against the input mouse splenic cDNA concentrations. The results were analyzed in the iCycler Optical System software, v.3.1 (Bio-Rad). The concentrations of the experimental samples were determined by interpolating threshold cycle values into the standard curve, and expression levels were computed by normalizing each cytokine concentration (in nanograms/milliliter) to the concentration of GAPDH cDNA in the sample (therefore, the resultant value had no unit of measurement).

Statistical evaluations. Serum GXM concentrations were analyzed using Student's t test for between-group comparisons after ascertaining the normality of distribution of the relevant data using a Kolmogorov-Smirnov test with a Dallal-Wilkinson-Lilliefors P value; for small sample sizes, where necessary, data were normalized using logarithmic transformations (GraphPad Prism). Survival data were analyzed by comparing Kaplan-Meier survival curves with a log-rank (Mantel Cox) test (GraphPad Prism); after the log-rank test, a Gehan-Breslow-Wilcoxon (GBW) modification of the log-rank test was used in an exploratory manner to apply weightage to early events in experiments in which differences in early survival were observed (GraphPad Prism) (39). Life table analysis and Cox hazard regression analysis (SPSS for Windows, v.15; SPSS Inc., Chicago, IL) were done where appropriate to estimate the likelihood of deaths, hazard functions, and cumulative hazards. Correlation analysis, when used, was done using a nonparametric statistic Spearman's {rho} (SPSS). For all statistical evaluations of probability, a two-tailed P value of ≤0.05 has been considered significant; P values from the significance of difference comparisons that were low but did not reach significance (i.e., between 0.05 to 0.1; considered a trend toward significance), as well as P values from survival analyses, were reported as numerical values.


arrow
RESULTS
 
Vaccine efficacy in BALB/c and C57BL/6 mice: survival studies (experiments 1 and 2). P13DT vaccination resulted in a prolongation of survival of both BALB/c (median survival, 106 days) and C57BL/6 mice (median survival, >365 days) compared to that of DT vaccination (median survival for BALB/c mice, 86 days; for C57BL/6 mice, 268 days) (Fig. 1A and B). Although the survival difference was not statistically significant (P13DT versus DT for BALB/c, P = 0.2; for C57BL/6, P = 0.3), a Cox regression hazard analysis showed that the P13DT-vaccinated mice had a 57% (BALB/c) and 52% (C57BL/6) reduction in the likelihood of death compared to that of the DT-treated mice. The lack of statistical significance (at {alpha} = 0.05) in otherwise biologically important observations in this experiment was found to be a function of small sample size (n = 5 in each group), because variances among sample values were not significant (data not shown). A similar trend also was observed in P13TT-vaccinated BALB/c and C57BL/6 mice: P13TT vaccination prolonged the survival of BALB/c (median survival, >260 days) and C57BL/6 mice (median survival, >280 days) compared to that of TT-vaccinated (median survival for BALB/c, 31 days; for C57BL/6, >280 days) or PBS-treated controls (median survival for BALB/c, 51 days; for C57BL/6, 186 days) (Fig. 1C and D). Although these comparisons were not statistically significant for BALB/c mice (n = 7), the survival of P13TT-vaccinated C57BL/6 mice was significantly longer than that of TT-vaccinated (P < 0.04) or PBS-treated (P < 0.02) mice (n = 12). Also, by the Cox regression hazard analysis, P13TT vaccination was associated with a reduction in the risk of death compared to that of TT and PBS (BALB/c mice, 62 and 31% reduction, respectively; C57BL/6 mice, 88 and 85% reduction, respectively).


Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 1. Survival of chronically infected BALB/c and C57BL/6 mice after vaccination with P13-protein conjugates and control treatments. (A and C) BALB/c and (B and D) C57BL/6 mouse survival outcomes after P13DT vaccination (A and B) and P13TT vaccination (C and D). Median survival (in days) for P13DT-vaccinated mice: BALB/c, 106; and C57BL/6, >365. Median survival (in days) for DT-vaccinated mice: BALB/c, 86; C57BL/6, 268. P13DT-vaccinated mice had a 57% (BALB/c) and 52% (C57BL/6) reduction in the likelihood of death compared to that of the DT-treated mice (n = 5 in each group). Median survival (in days) according to treatment type was the following: P13TT-treated mice, BALB/c, >260; C57BL/6, >280; TT-treated mice, BALB/c, 31; C57BL/6, >280; PBS-treated mice, BALB/c, 51; C57BL/6, 186. Survival in P13TT-vaccinated C57BL/6 mice was significantly higher than that in TT-vaccinated (P < 0.04) or PBS-treated (P < 0.02) mice and was associated with a reduction in the risk of death compared to that for TT and PBS treatment (BALB/c, 62 and 31% reduction, respectively; C57BL/6, 88 and 85% reduction, respectively) (BALB/c, n = 7; C57BL/6, n = 12). (E and F) Identically conducted experiments in BALB/c mice comparing the effects of TT and DT to those of P13. Data represent the composite of two sets of independent but identical experiments. For the comparison of the P13DT vaccination and DT vaccination, P = 0.09; for the comparison of the P13DT vaccination and PBS, P < 0.021; each is by the GBW test. Median survival according to treatment type (in days): P13DT, 135; DT, 81; and PBS, 56. P13DT vaccination was associated with a 50% reduction in the likelihood of death compared to that for DT and was 61% compared to that for PBS (n = 11 for P13DT; n = 11 for DT; and n = 6 for PBS). Median survival (days) according to treatment type: P13TT, 140; TT, 134; and PBS, 52. P13TT reduced the likelihood of death by 40% compared to that of TT and 44% compared to that of PBS (n = 12 for P13TT; n = 13 for TT; and n = 12 for PBS).

Effect of carrier proteins in P13 vaccines: survival studies of BALB/c mice (experiment 3). Studies to compare the effects of two carrier proteins, TT and DT, were performed in BALB/c mice, because they were more likely to die from the chronic infection than C57BL/6 mice. For each carrier protein (DT and TT), two independent experiments were performed, using the P13 conjugate as the vaccine and using the carrier and PBS as controls, and the data were pooled (for the P13DT experiments, n = 11 for P13DT treatment, n = 11 for DT treatment, and n = 6 for PBS treatment; for the P13TT experiments, n = 12 for P13TT, n = 13 for TT, and n = 12 for PBS). In the P13DT experiments (Fig. 1E), P13DT vaccination prolonged survival (median survival, 135 days) of chronically infected mice compared to DT vaccination (median survival, 81 days; GBW, P = 0.09 [not significant at {alpha} = 0.05]) and PBS treatment (median survival, 56 days; GBW, P < 0.021). For the P13TT conjugate, the relative group differences were weaker (Fig. 1F); P13TT vaccination increased the median survival of mice to 140 days, compared to 134 and 52 days for TT and PBS, respectively, but the difference did not reach statistical significance. A Cox regression hazard analysis showed that P13DT vaccination was associated with a 50% reduction in the likelihood of death compared to DT and 61% compared to PBS, whereas P13TT reduced the likelihood of death by 40% compared to TT and 44% compared to PBS. Hence, in BALB/c mice, although the duration of survival of P13DT- and P13TT-vaccinated and PBS-treated mice was similar, DT-vaccinated mice survived longer than TT-vaccinated mice, with the caveat that the differences were not statistically significant.

Serum GXM levels in vaccinated mice. In BALB/c mice, P13DT-vaccinated mice had lower serum GXM levels on day 18 PV than DT-treated mice, but these differences were not statistically significant. Similarly, the P13DT-vaccinated C57BL/6 mice had lower serum GXM levels than DT-treated mice on all PV days tested, but the differences were not statistically significant (Fig. 2A and B). Differences in GXM levels between P13TT-vaccinated and TT-vaccinated controls were most prominent in C57BL/6 mice; however, the levels in the P13TT-vaccinated groups in both mouse strains were significantly lower (P < 0.04) than those in the PBS groups at the early PV time. At the other times we examined, differences in GXM levels between groups were not statistically significant (Fig. 2C and D).


Figure 2
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 2. Effect of the P13-protein conjugate vaccines on serum GXM levels. (A, C, and E) BALB/c mice; (B, D, and F) C57BL/6 mice. (A and B) Serial GXM concentrations in serum samples from the P13DT vaccination study, collected at day 20 postinfection (d20 PI), day 18 PV (d18 pV), day 34 PV (d34 PV) for both BALB/c and C57BL/6 mice, and additionally at day 84 PV (d84 PV) for C57BL/6 mice (n = 5 for each). (C and D) Data from the P13TT vaccination study; the times indicated are serum GXM levels prior to vaccination (PRE-vac), prior to revaccination (Pre-revac; data pooled from days 7 and 14 PV), early after revaccination (Early postrevac; data pooled from days 23 and 28 PV), or late after revaccination (Late postrevac; day 38 PV). Differences in GXM levels were not statistically significant at {alpha} = 0.05, except that at early postrevaccination times the P13TT group had significantly lower GXM concentrations (P < 0.04) than the PBS group in both mouse strains. (E and F) Negative correlations, observed across all groups, of serum GXM concentration with survival times; in P13DT studies, the correlations between the day of death and serum GXM concentrations measured prior to death were the following: BALB/c mice, Spearman {rho} = –0.74, P = 0.02; C57BL/6 mice, Spearman {rho} = –0.81, P < 0.011. In P13TT studies, the correlations between the day of death and serum GXM concentrations measured prior to death were the following: BALB/c mice, Spearman {rho} = –0.66, P < 0.001; C57BL/6 mice, Spearman {rho} = –0.47, P < 0.042.

For P13 vaccination with either carrier protein, the serum GXM concentration had a significantly negative correlation with survival times. For P13DT, the correlations between the day of death and serum GXM concentrations measured prior to death were the following: for BALB/c mice, Spearman {rho} = –0.74, P = 0.02; for C57BL/6 mice, Spearman {rho} = –0.81, P < 0.011. For P13TT, the correlation between the day of death and serum GXM concentrations measured prior to death were the following: BALB/c mice, Spearman {rho} = –0.66, P < 0.001; for C57BL/6 mice, Spearman {rho} = –0.47, P < 0.042. A subgroup analysis revealed that the significance of this correlation was driven by the values in the DT-treated mice (P < 0.04 in both mouse strains) compared to those in P13DT-vaccinated mice (P < 0.12 and P < 0.19 in C57BL/6 and BALB/c mice, respectively). Similarly, in the P13TT experiments, this correlation for C57BL/6 mice was driven by the values in the TT-treated mice (P < 0.033). However, for the BALB/c mice, GXM values for both P13TT and TT were significantly correlated (P < 0.05) with the day of death. Representative figures of these correlations are shown (Fig. 2G and H). Overall, C57BL/6 mice showed better control of serum GXM levels and more resistance to the chronic CN24067 infection than BALB/c mice.

Vaccine efficacy in BALB/c mice: survival in acute low-inoculum infection model. The i.v. infection experiment was censored on day 64, when the last naïve infected control mouse died (data not shown). The mice vaccinated with P13TT demonstrated a prolongation of survival for about 2 months into the study period (median survival, 56.5 days) compared to that of the mice that received TT or PBS (median survivals, 35 and 30 days, respectively) (Fig. 3A and B). GBW P values for survival comparison between groups were the following: P13TT and TT, P < 0.25 (not significant); P13TT and PBS, P < 0.045. The P value for comparison between TT and PBS was not significant. P13DT and DT both were ineffective (data not shown).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 3. Efficacy of P13TT in the systemic (i.v.) low-inoculum infection model. (A) Survival of infected BALB/c mice after vaccination with P13TT (black circle) or TT (hollow circle) or treatment with PBS (hollow box); n = 6 for each group. For P13TT versus PBS, P < 0.045. (B) Cumulative hazard curves for the mouse groups shown in panel A. P13TT reduced the likelihood of death by 36 and 61% compared to those of TT and PBS. (C) Survival of naïve BALB/c mice following the administration of day-10 PV serum from i.v. infected, vaccinated BALB/c mice and subsequent lethal challenge. For P13TT versus TT, P < 0.054 by log-rank test; P < 0.038 by GBW; and P13TT versus infection control, P < 0.01 by log-rank test. (D) Cumulative hazard curves for the mouse groups in panel C. Compared to the infection control, P13TT serum, TT serum, and untreated-infected serum reduced the likelihood of death by 82, 32, and 40%, respectively. Compared to untreated-infected serum, P13TT serum reduced, but TT serum enhanced, the likelihood of death by 70 and 13%, respectively. n = 5 for each group.

Passive protection of naïve BALB/c mice with chronically infected, vaccinated BALB/c sera. Serum (collected on day 10 following vaccination, which was day 14 following chronic infection) from i.v.-infected, P13TT-vaccinated BALB/c mice (median survival, 18 days) prolonged survival in naïve BALB/c mice against a lethal cryptococcal challenge compared to that from TT-vaccinated (median survival, 16 days; log-rank P < 0.054; GBW P < 0.038) or untreated-infected mice (median survival, 14 days; log-rank P = 0.13, not significant). Compared to that of the infection control (median survival, 14 days), the prolongation of survival in the P13TT group was highly significant (log-rank P < 0.01) (Fig. 3C and D). There was a borderline significant trend showing increasing efficacy from untreated-infected TT serum to P13TT serum in the prolongation of survival (log-rank test for trend, P < 0.059). Cox regression hazard analysis showed that, compared to the infection control, P13TT serum reduced the likelihood of death by 82% (P < 0.03), whereas these reductions in TT and untreated-infected sera were 32 and 40%, respectively. Compared to untreated-infected serum, P13TT serum reduced, but TT serum enhanced, the likelihood of death by 70 and 13%, respectively, but neither difference was statistically significant. Serum from P13DT- or DT-vaccinated mice was not effective at all (data not shown). Sera from PBS-treated mice could not be tested.

Study of the host cytokine milieu: single-point PV estimation. The expression levels of IFN-{gamma}, IL-10, and IL-6 genes (as copy numbers of cytokine mRNAs) in whole blood were measured by real-time PCR at a single time, day 34 PV (day 58 post infection), a time that is 1 month after vaccination and nearly 2 months after infection, at which time the mice appeared well and were not expected to die from the chronic inoculum that had been administered. The cytokines chosen for study were selected because of their importance in the pathogenesis of cryptococcosis (see Discussion). Untreated, naïve C57BL/6 mice had a higher preexisting baseline expression of the cytokines compared to that of naïve BALB/c mice; however, for both mouse strains, the mean expression level of IL-10 was similar to that of IFN-{gamma} in the naïve mice, leading to an equivalent mean integral IL-10/IFN-{gamma} ratio in the untreated, naïve group of the respective strain (Fig. 4A to C). For both C57BL/6 and BALB/c mice, the P13DT-vaccinated mice had lower levels of the cytokines that were examined compared to those of the control, DT-treated mice, though the results did not reach statistical significance, perhaps owing to the small sample size (n = 4 to 6) (Fig. 4A and B). The P13DT-vaccinated groups had lower integral IL-10/IFN-{gamma} ratios in C57BL/6 mice, and higher ratios in BALB/c mice, compared to those of the controls. These differences in the ratios indicate an IL-10 (Th2)-dominant response in the P13DT-vaccinated BALB/c mice and the same in the DT-vaccinated controls among the C57BL/6 mice (Fig. 4C).


Figure 4
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 4. Cytokine gene expression in peripheral blood cells. Data shown are from day 34 PV (day 12 following revaccination). Gene expression measured as mRNA copy numbers for the cytokines indicated on the y axis are shown with values normalized to those for GAPDH for the mice indicated on the x axis. (A) BALB/c mice; (B) C57BL/6 mice. Murine IFN-{gamma} (mIFN-{gamma}), IL-10 (mIL-10), and IL-6 (mIL-6) expression levels at day 34 in P13DT-vaccinated (hashed bar), DT-treated (black bar), and naïve mice (white bar); n = 4 to 6. (C) IL-10/IFN-{gamma} ratio in the vaccinated and untreated, naïve mice for the strains indicated on the x axis.

Kinetics of PV cytokine changes in chronically infected mice. The expression of IFN-{gamma}, IL-10, and IL-6 genes in whole blood, as measured by real-time PCR, was found to change over time in both BALB/c and C57BL/6 mice following vaccination with P13TT or the control treatments, TT and PBS (Fig. 5A to F). In the BALB/c mice, the expression of all three cytokines gradually increased from day 7 PV, with a minimal difference between the groups. In the C57BL/6 mice, IFN-{gamma} and IL-10 expression levels were lower in P13TT- than in TT-vaccinated mice, and revaccination was associated with a reduction in IFN-{gamma} and IL-10 expression in the TT-treated group. P13TT-vaccinated C57BL/6 mice also had consistently higher IL-6 expression levels than TT-vaccinated mice. The cytokine response in PBS-treated mice followed the time frame of vaccination, including an increase after revaccination. In all groups, there was a highly significant positive correlation (P < 0.001) between the level of expression of the proinflammatory cytokine IFN-{gamma} and the antiinflammatory cytokine IL-10 (data not shown). The overall levels of cytokines detected in BALB/c mice were higher than those in C57BL/6 mice. For BALB/c mice, the ratios of IL-10/IFN-{gamma} levels were comparable between P13TT- and TT-vaccinated mice except on day 7; for C57BL/6 mice, the higher ratio in P13TT-vaccinated mice (compared to TT-vaccinated mice) seen at days 1 to 14 of vaccination was reversed after revaccination, but the differences were not statistically significant (Fig. 5G, H). These cytokine levels were not directly correlated with the survival outcome, with P13TT-vaccinated mice surviving longer than the controls for both BALB/c and C57BL/6 mice (Fig. 1C, D).


Figure 5
View larger version (35K):
[in this window]
[in a new window]

  		FIG. 5. Kinetics of cytokine gene expression in chronically infected mice. (A, C, E, and G) BALB/c mice; (B, D, F, and H) C57BL/6 mice. (A to F) Changes in the expression of IFN-{gamma}, IL-10, and IL-6 genes at the times indicated on the x axis after vaccination with P13TT (or control treatment, TT and PBS); the arrow represents revaccination on day 21. (G and H) Ratio of IL-10/IFN-{gamma} levels in all groups.

Correlation of cytokine levels with serum GXM concentration. In chronically infected (i.p. model) and vaccinated BALB/c and C57BL/6 mice from the survival experiments (described above), correlation analysis was performed on the cytokine mRNA expression levels of P13TT-vaccinated and control-treated mice and corresponding serum GXM levels. The IFN-{gamma} and IL-10 (but not IL-6) levels in the P13TT-vaccinated BALB/c mice (n = 25 across all time points tested) and TT-vaccinated C57BL/6 mice (n = 22) were moderately associated (Spearman's {rho} range, 0.42 to 0.51) but significantly correlated (P < 0.05 for C57BL/6 and P < 0.02 for BALB/c) with serum GXM concentrations in individual mice (Fig. 6A to F). The carriers did worse than the PBS controls in most experiments, suggesting that they exerted a detrimental effect. However, this correlation was not seen in any of the other vaccine or PBS control mouse groups. No correlation with GXM levels was found when serum IL-10 and IFN-{gamma} proteins were measured in BALB/c mice in a separate experiment that used commercial ELISA-based kits for cytokine measurement (R&D Biosystems, Minneapolis, MN); IFN-{gamma} was detectable in serum within 24 h of vaccination, but IL-10 did not appear in the serum in detectable quantities until day 7. There was no correspondence between measured serum protein (by ELISA) and the cytokine mRNA expression (by real-time PCR) (data not shown).


Figure 6
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 6. Correlation of cytokine levels with serum GXM concentration (conc). Correlation analysis was carried on the cytokine mRNA expression levels of P13TT-vaccinated and control-treated mice over a period of PV time points and their corresponding serum GXM levels. The IFN-{gamma} and IL-10 (but not IL-6) levels in the P13TT-vaccinated BALB/c mice (n = 25, pooled across all time points tested) and TT-treated C57BL/6 mice (n = 22) were moderately associated (Spearman's {rho} range, 0.42 to 0.51) but significantly correlated (P < 0.05 in C57BL/6 and P < 0.02 in BALB/c mice; indicated with asterisks) with serum GXM concentrations in individual mice.


arrow
DISCUSSION
 
To our knowledge, this study is the first to investigate the feasibility of vaccination for C. neoformans in the setting of preexisting infection. This question is relevant to human cryptococcosis, which is a chronic disease that often reflects the reactivation of latent infection in patients with impaired immunity (25, 55, 61). The model we developed for this study resulted in a chronic C. neoformans infection that progressed over time. Interestingly, we found that, when infected similarly with C. neoformans, naïve C57BL/6 mice survived longer than naïve BALB/c mice. Again, though the P13-protein conjugate vaccination of both strains of chronically infected mice resulted in a prolongation of their survival compared to that of control mice, the degree of protection was influenced by the mouse strain; P13-vaccinated C57BL/6 mice survived longer than P13-vaccinated BALB/c mice. This finding is consistent with studies of antibody-mediated protection in experimental murine cryptococcosis that reported an association between antibody efficacy and the mouse genetic background (53).

Based on our finding that heat-inactivated sera from P13TT-vaccinated mice conferred protection in naïve mice, it is likely that P13TT-mediated protection involved the enhancement of antibody-mediated immunity. Ideally, the hypothesis that immunity is antibody mediated is supported by specific antibody titers. However, we were not able to determine antibody titers in the setting of chronic infection because of the presence of serum antigen (GXM). GXM forms immune complexes with serum antibodies that confound accurate measurements of specific antibody. In support of the hypothesis that protection was antibody mediated, P13TT was ineffective in B-cell knockout (µMT) mice (data not shown). Furthermore, there is ample data from previous studies of naïve mice that the P13-protein conjugates induce GXM-reactive antibody (24, 41). In this regard, the passive immunization results reported herein corroborate previous studies with P13-protein conjugates, in which immune sera from vaccinated mice enhanced the survival of naïve, infected mice (24, 42). In aggregate, these observations suggest that vaccines that induce antibody-mediated mechanisms of protection against C. neoformans hold promise in the setting of acute and latent infection. Nonetheless, the modest degree of protection conferred by passive immunization in this and other studies with P13-protein conjugates underscores the need to gain a better understanding of mechanisms that govern antibody-mediated protection and to identify parameters by which it can be measured. The efficacy of defined antibodies to GXM in murine cryptococcosis has been well documented (12, 40). Since mixtures of protective and detrimental antibodies can diminish antibody-mediated protection (48), the use of polyclonal sera in this study might have contributed to the modest degree of protection conferred by the passive transfer of immune sera. Another factor that could have reduced the efficacy of immune sera is the deleterious effect of GXM in the administered sera. Our data also raise the possibility of the carrier-mediated enhancement of disease; for example, TT vaccination was associated with a greater risk of death in all models tested. Some carriers induce detrimental antibodies to GXM (44), and the robustness of the antibody response can be limited by carrier-mediated suppression (20). We were not able to evaluate other carriers in this study.

P13-protein conjugate-mediated protection against acute, lethal cryptococcosis in naïve mice previously was shown to be associated with a reduction in serum GXM (24, 41, 42). In the chronic infection model used in this study, there was a highly significant correlation between serum GXM levels and the day of death in both mouse strains, but GXM levels were not significantly reduced in P13-vaccinated mice compared to those of control mice. Hence, our data show that the effect of vaccination on survival cannot be predicted by serum GXM levels. The relationship between serum GXM levels and disease status is not straightforward. High serum GXM levels can have a prognostic value in human immunodeficiency virus-associated cryptococcosis (21, 37), but low GXM levels often are poor predictors of clinical status (3, 13, 58). The lack of significant differences between the levels of GXM we found in P13-protein conjugate and control mice could be a function of the small sample size, a problem inherent in the chronic infection model (which is skewed toward and limited by the number of mice that do not clear the inoculum within 7 days, as estimated by serum GXM levels). It is also possible that, in our model, there might have been greater differences in GXM levels at later times after infection. However, the lack of association between GXM levels and clinical outcome might stem from other factors as well. The relationship between serum GXM levels and the fungal burden in murine cryptococcosis is uncertain. GXM is cleared from the serum and subsequently sequestered in tissues, predominantly liver and spleen (28, 34, 66). Since the same level of serum GXM could be found in mice with different amounts of tissue sequestration, the amount of GXM in tissue and/or the number of organ CFU might be more predictive of disease status, with the caveat that antibody efficacy in murine cryptococcosis does not necessarily correlate with a reduction in the fungal burden (23). Since GXM has deleterious effects and a specific antibody can reduce these effects by enhancing the clearance of GXM, the net GXM level in the serum of chronically infected mice could reflect a complex interplay among fungal growth and GXM sequestration in tissue. In light of these complexities, our data suggest that better surrogates for vaccine efficacy are needed, but to date none have been identified for cryptococcal disease.

The survival differences between P13-vaccinated and control mice in our study suggest that the P13-based conjugates have beneficial effects on host immunity that cannot be predicted by serum GXM levels. To probe other mechanisms of protection in our model, we investigated the possibility that immunization induced differential immunomodulation, as observed for other diseases (38). In the light of our previous observation suggesting that P13 conjugates enhance innate immune mechanisms (42), as well as evidence that Th1-like immunity is important for host defense against cryptococcosis (60, 62), we compared the expression of IFN-{gamma} (31, 68) and IL-10, an immunosuppressive cytokine that is linked to Th2-like immune responses (17, 46), in P13-protein conjugate and control mice. In consonance with the evidence that cryptococcosis develops in the setting of a Th2-like bias (2, 33, 54), we observed more expression of IL-10 than IFN-{gamma} in all experimental groups. Naïve C57BL/6 mice had higher baseline cytokine expression levels than naïve BALB/c mice, but the mean integral IL-10/IFN-{gamma} ratio was similar for both strains. However, this ratio changed in each mouse strain after infection and, subsequently, after vaccination. P13DT vaccination reduced the level of IL-10 relative to that of IFN-{gamma} in C57BL/6 mice, but it had the opposite effect in BALB/c mice, increasing the relative level of IL-10. Hence, vaccination with a P13 conjugate recapitulated the natural response, inducing more of a Th1-like response in C57BL/6 mice and a Th2-like response in BALB/c mice. In contrast, DT vaccination had the opposite effect, suggesting that DT and the peptide moiety (P13) had dichotomous effects on the immune response, depending on the mouse strain. Since toxoids are strong immunomodulators, it is not surprising that a carrier would have an independent effect. However, our analysis, which separated the effect of the carrier and the peptide-carrier conjugate, suggests the hypothesis that the carrier has reduced beneficial effects induced by the peptide moiety, which in turn contributed to a reduced effect of immunization on survival. Our data also suggest that vaccine efficacy depends only on the enhancement of a Th1-like immune response in C57BL/6 mice, since a lower ratio of IL-10 to IFN-{gamma} was associated with a beneficial effect only in C57BL/6 mice. P13TT vaccination also reduced the levels of IL-10 relative to those of IFN-{gamma} in C57BL/6 mice, albeit after revaccination, but in BALB/c mice, both P13TT and TT lowered the relative levels of these two cytokines. Regarding the relative importance of Th1- and Th2-like responses, Th2 cytokines, in addition to Th1 cytokines, enhanced antibody efficacy against C. neoformans in mice (6), albeit in acute lethal models of pulmonary cryptococcosis. Taken together, our data indicate that vaccine-induced immunomodulatory effects are a function of the carrier protein and the mouse strain and suggest that more studies are needed to identify the effects that promote vaccine efficacy in the setting of chronic infection.

Our observation that IL-6 mRNA expression was higher in control than vaccinated mice is at variance with data from an intracerebral cryptococcosis model (8). This difference may stem from the use of different infection models, i.e., cryptococcal strains or mouse strains. However, the lack of correlation between IL-6 levels and the fungal burden in our study resembles that of a study on the similarity of cytokine profiles between AIDS patients with cryptococcosis and mice challenged systemically with C. neoformans (36). IL-6 biology in cryptococcosis is not fully understood, as illustrated by the observation that opsonized C. neoformans elicited only IL-6 mRNA from immune cells during a narrow window of time following infection, and the IL-6 response depends on the cryptococcal strain (35). We also examined IL-12 expression, but, consistently with the low level of IFN-{gamma} mRNA expression in our study, it was very low in all the groups (data not shown). There are several caveats to our cytokine studies. First, we chose to study the cytokines that we examined based on their historical importance in acute infection models of cryptococcosis, but other cytokines and chemokines and/or the enhancement of innate immune mechanisms could contribute to survival in the setting of a chronic infection model. In addition, we determined gene expression in peripheral blood cells, because this could be done nonterminally in the course of observing survival. However, cytokine expression in circulating cells might be inadequate to fully characterize the effect of immunization on the immune response to C. neoformans. In this regard, tissue cytokine gene expression and/or protein levels, albeit in a terminal model, are likely to be more robust and quantifiable (9). The possibility of examining other cytokines and mediators notwithstanding, the study of individual cytokines could be unlikely to explain the immunomodulatory effects of immunization in chronic infection in light of the complex interplay of microbial and host factors with the added variables of vaccine, carrier protein, and the responses they induce. In this regard, the use of microarrays or other techniques to investigate vaccine-induced immune response signatures is likely to provide a more robust and complete picture.

The carrier protein in the P13 conjugates influenced vaccine efficacy depending on the infection model used. P13DT prolonged survival in the i.p. infection model, whereas P13TT prolonged survival in the i.v. model. This phenomenon also was observed in vaccination challenge models in acute C. neoformans infection models (41). Protein carriers can influence the specificity, function, avidity, and idiotype of the antibody response to polysaccharide-protein conjugate vaccines (5, 27, 57). In addition, TT-conjugated antigens produce less anticarrier protein antibodies than DT-conjugated antigens, whereas DT conjugation can release more free haptens than TT (65). The induction of nonprotective or detrimental antibodies by the carrier also is possible. For example, keyhole limpet hemocyanin-induced antibodies were detrimental in mice that were vaccinated with another GXM mimotope conjugated to keyhole limpet hemocyanin and infected with C. neoformans (44). Our data support the conclusion of previous studies that more work is needed to identify the optimal carrier protein for mimotope vaccines for C. neoformans.

In summary, in this study, we employed a novel chronic infection model to investigate the efficacy of GXM peptide mimotope-protein conjugates in the setting of an already-established cryptococcal infection. It would be interesting to determine the ability of the P13-protein conjugates to enhance the host response to pulmonary infection, but the currently employed models of pulmonary disease are high-inoculum models that result in florid pneumonia, which is not representative of human disease. A pulmonary model that results in latent disease might recapitulate human disease more accurately, and we hope to develop such a model for future studies. However, we note that although it is not the natural route of infection, the chronic i.p. model we used in this study has several important features of human disease, such as (clinical) progression with meningitis as a terminal event (as observed from the recovery of CFU from the brain). Our data show that the vaccination of chronically infected mice with a GXM peptide mimotope-protein conjugate resulted in the prolongation of their survival; however, there were differences in vaccine efficacy and the immunomodulatory effects of the conjugates in BALB/c and C57BL/6 mice. Although the precise mechanism by which immunization enhanced survival remains uncertain, our data indicate that protection was associated with the vaccine-mediated augmentation of the naturally occurring immune response to C. neoformans in both strains of mice. Our findings suggest that vaccine efficacy in the setting of chronic infection could be a function of the recapitulation of natural immunity and call for a better understanding of natural resistance to cryptococcosis.


arrow
ACKNOWLEDGMENTS
 
This work was supported by R01AI035370, R01AI045459, and R01AI044374 (to L.P.).

We thank Arturo Casadevall of the Albert Einstein College of Medicine, Bronx, NY, for providing reagents for this study.

We have no financial interest in this body of work.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Albert Einstein College of Medicine, Medicine/Infectious Diseases, 1300 Morris Park Ave., Room 709, Forchheimer Bldg., Bronx, NY 10461. Phone: (718) 430-2372. Fax: (718) 430-8968. E-mail: pirofski{at}aecom.yu.edu Back

{triangledown} Published ahead of print on 4 June 2008. Back

{dagger} Present address: Oregon Health & Science University, HRC-330A (Mailcode: L-457), 3181 Sam Jackson Park Road, Portland, OR 97239. Back

{ddagger} Present address: Fina BioSolutions LLC, 9610 Medical Center Dr., Suite 200, Rockville, MD 20850. Back


arrow
REFERENCES
 
    1
  1. Abadi, J., and L. Pirofski. 1999. Antibodies reactive with the cryptococcal capsular polysaccharide glucuronoxylomannan are present in sera from children with and without human immunodeficiency virus infection. J. Infect. Dis. 180:915-919.[CrossRef][Medline]
    2. 2
  2. Abe, K., J. Kadota, Y. Ishimatsu, T. Iwashita, K. Tomono, K. Kawakami, and S. Kohno. 2000. Th1-Th2 cytokine kinetics in the bronchoalveolar lavage fluid of mice infected with Cryptococcus neoformans of different virulences. Microbiol. Immunol. 44:849-855.[Medline]
    3. 3
  3. Aberg, J. A., J. Watson, M. Segal, and L. W. Chang. 2000. Clinical utility of monitoring serum cryptococcal antigen (sCRAG) titers in patients with AIDS-related cryptococcal disease. HIV. Clin. Trials 1:1-6.[Medline]
    4. 4
  4. Banerjee, U., K. Datta, T. Majumdar, and K. Gupta. 2001. Cryptococcosis in India: the awakening of a giant? Med. Mycol. 39:51-67.[Medline]
    5. 5
  5. Batzloff, M. R., W. A. Hayman, M. R. Davies, M. Zeng, S. Pruksakorn, E. R. Brandt, and M. F. Good. 2003. Protection against group A streptococcus by immunization with J8-diphtheria toxoid: contribution of J8- and diphtheria toxoid-specific antibodies to protection. J. Infect. Dis. 187:1598-1608.[CrossRef][Medline]
    6. 6
  6. Beenhouwer, D. O., S. Shapiro, M. Feldmesser, A. Casadevall, and M. D. Scharff. 2001. Both Th1 and Th2 cytokines affect the ability of monoclonal antibodies to protect mice against Cryptococcus neoformans. Infect. Immun. 69:6445-6455.[Abstract/Free Full Text]
    7. 7
  7. Bhattacharjee, A. K., J. E. Bennett, and C. P. J. Glaudemans. 1984. Capsular polysaccharides of Cryptococcus neoformans. Rev. Infect. Dis. 6:619-624.[Medline]
    8. 8
  8. Blasi, E., R. Barluzzi, R. Mazzolla, L. Pitzurra, M. Puliti, S. Saleppico, and F. Bistoni. 1995. Biomolecular events involved in anticryptococcal resistance in the brain. Infect. Immun. 63:1218-1222.[Abstract]
    9. 9
  9. Burns, T., M. Abadi, and L. A. Pirofski. 2005. Modulation of the lung inflammatory response to serotype 8 pneumococcal infection by a human immunoglobulin M monoclonal antibody to serotype 8 capsular polysaccharide. Infect. Immun. 73:4530-4538.[Abstract/Free Full Text]
    10. 10
  10. Casadevall, A., and J. R. Perfect. 1998. Cryptococcus neoformans. American Society for Microbiology, Washington, DC.
    11. 11
  11. Casadevall, A., and L. A. Pirofski. 2003. The damage-response framework of microbial pathogenesis. Nat. Rev. Microbiol. 1:17-24.[CrossRef][Medline]
    12. 12
  12. Casadevall, A., and L. A. Pirofski. 2005. Insights into mechanisms of antibody-mediated immunity from studies with Cryptococcus neoformans. Curr. Mol. Med. 5:421-433.[CrossRef][Medline]
    13. 13
  13. Chang, W. C., C. Tzao, H. H. Hsu, S. C. Lee, K. L. Huang, H. J. Tung, and C. Y. Chen. 2006. Pulmonary cryptococcosis: comparison of clinical and radiographic characteristics in immunocompetent and immunocompromised patients. Chest 129:333-340.[CrossRef][Medline]
    14. 14
  14. Chen, H. S., W. P. Tsai, H. S. Leu, H. H. Ho, and L. B. Liou. 2007. Invasive fungal infection in systemic lupus erythematosus: an analysis of 15 cases and a literature review. Rheumatology (Oxford) 46:539-544.[CrossRef][Medline]
    15. 15
  15. Chen, L. C., L. A. Pirofski, and A. Casadevall. 1997. Extracellular proteins of Cryptococcus neoformans and host antibody response. Infect. Immun. 65:2599-2605.[Abstract]
    16. 16
  16. Cherniak, R., L. C. Morris, B. C. Anderson, and S. A. Meyer. 1991. Facilitated isolation, purification, and analysis of glucuronoxylomannan of Cryptococcus neoformans. Infect. Immun. 59:59-64.[Abstract/Free Full Text]
    17. 17
  17. Chiapello, L. S., J. L. Baronetti, M. P. Aoki, S. Gea, H. Rubinstein, and D. T. Masih. 2004. Immunosuppression, interleukin-10 synthesis and apoptosis are induced in rats inoculated with Cryptococcus neoformans glucuronoxylomannan. Immunology 113:392-400.[CrossRef][Medline]
    18. 18
  18. Cleare, W., R. Cherniak, and A. Casadevall. 1999. In vitro and in vivo stability of a Cryptococcus neoformans glucuronoxylomannan epitope that elicits protective antibodies. Infect. Immun. 67:3096-3107. (Erratum, 67:3702.)[Abstract/Free Full Text]
    19. 19
  19. Datta, K., and L. A. Pirofski. 2006. Towards a vaccine for Cryptococcus neoformans: principles and caveats. FEMS Yeast Res. 6:525-536.[CrossRef][Medline]
    20. 20
  20. Donnenberg, A. D., G. J. Elfenbein, and G. W. Santos. 1984. Secondary immunization with a protein antigen (tetanus toxoid) in man. Characterization of humoral and cell-mediated regulatory events. Scand. J. Immunol. 20:279-289.[CrossRef][Medline]
    21. 21
  21. Dromer, F., S. Mathoulin-Pelissier, O. Launay, and O. Lortholary. 2007. Determinants of disease presentation and outcome during cryptococcosis: the CryptoA/D study. PLoS. Med. 4:e21.[CrossRef][Medline]
    22. 22
  22. Dubois, M., K. A. Giles, J. K. Hamilton, P. A. Rebers, and F. Smith. 1956. Colorimetric method for determination of sugars and related substances. Anal. Chem. 28:350-358.
    23. 23
  23. Feldmesser, M., and A. Casadevall. 1997. Effect of serum IgG1 to Cryptococcus neoformans glucuronoxylomannan on murine pulmonary infection. J. Immunol. 158:790-799.[Abstract]
    24. 24
  24. Fleuridor, R., A. Lees, and L. Pirofski. 2001. A cryptococcal capsular polysaccharide mimotope prolongs the survival of mice with Cryptococcus neoformans infection. J. Immunol. 166:1087-1096.[Abstract/Free Full Text]
    25. 25
  25. Garcia-Hermoso, D., G. Janbon, and F. Dromer. 1999. Epidemiologic evidence for dormant Cryptococcus neoformans infection. J. Clin. Microbiol. 37:3204-3209.[Abstract/Free Full Text]
    26. 26
  26. Goldman, D. L., H. Khine, J. Abadi, D. L. Lindenberg, L. Pirofski, R. Niang, and A. Casadevall. 2001. Serologic evidence for Cryptococcus neoformans infection in early childhood. Pediatrics 107:E66.[CrossRef][Medline]
    27. 27
  27. Granoff, D. M., P. G. Shackelford, S. J. Holmes, A. H. Lucas, et al. 1993. Variable region expression in the antibody responses of infants vaccinated with Haemophilus influenzae type b polysaccharide-protein conjugates. Description of a new lambda light chain-associated idiotype and the relation between idiotype expression, avidity, and vaccine formulation. J. Clin. Investig. 91:788-796.[CrossRef][Medline]
    28. 28
  28. Grinsell, M., L. C. Weinhold, J. E. Cutler, Y. Han, and T. R. Kozel. 2001. In vivo clearance of glucuronoxylomannan, the major capsular polysaccharide of Cryptococcus neoformans: a critical role for tissue macrophages. J. Infect. Dis. 184:479-487.[CrossRef][Medline]
    29. 29
  29. Jalali, Z., L. Ng, N. Singh, and L. A. Pirofski. 2006. Antibody response to Cryptococcus neoformans capsular polysaccharide glucuronoxylomannan in patients after solid-organ transplantation. Clin. Vaccine Immunol. 13:740-746.[Abstract/Free Full Text]
    30. 30
  30. Jenny-Avital, E. R., and M. Abadi. 2002. Immune reconstitution cryptococcosis after initiation of successful highly active antiretroviral therapy. Clin. Infect. Dis. 35:e128-e133.[CrossRef][Medline]
    31. 31
  31. Kawakami, K., M. Tohyama, K. Teruya, N. Kudeken, Q. Xie, and A. Saito. 1996. Contribution of interferon-gamma in protecting mice during pulmonary and disseminated infection with Cryptococcus neoformans. FEMS Immunol. Med. Microbiol. 13:123-130.[Medline]
    32. 32
  32. Kiertiburanakul, S., S. Wirojtananugoon, R. Pracharktam, and S. Sungkanuparph. 2006. Cryptococcosis in human immunodeficiency virus-negative patients. Int. J. Infect. Dis. 10:72-78.[CrossRef][Medline]
    33. 33
  33. Koguchi, Y., and K. Kawakami. 2002. Cryptococcal infection and Th1-Th2 cytokine balance. Int. Rev. Immunol. 21:423-438.[CrossRef][Medline]
    34. 34
  34. Lendvai, N., A. Casadevall, Z. Liang, D. L. Goldman, J. Mukherjee, and L. Zuckier. 1998. Effect of immune mechanisms on the pharmacokinetics and organ distribution of cryptococcal polysaccharide. J. Infect. Dis. 177:1647-1659.[Medline]
    35. 35
  35. Li, R. K., and T. G. Mitchell. 1997. Induction of interleukin-6 mRNA in rat alveolar macrophages by in vitro exposure to both Cryptococcus neoformans and anti-C. neoformans antiserum. J. Med. Vet. Mycol. 35:327-334.[Medline]
    36. 36
  36. Lortholary, O., L. Improvisi, N. Rayhane, F. Gray, C. Fitting, J. M. Cavaillon, and F. Dromer. 1999. Cytokine profiles of AIDS patients are similar to those of mice with disseminated Cryptococcus neoformans infection. Infect. Immun. 67:6314-6320.[Abstract/Free Full Text]
    37. 37
  37. Lortholary, O., G. Poizat, V. Zeller, S. Neuville, A. Boibieux, M. Alvarez, P. Dellamonica, F. Botterel, F. Dromer, and G. Chene. 2006. Long-term outcome of AIDS-associated cryptococcosis in the era of combination antiretroviral therapy. AIDS 20:2183-2191.[Medline]
    38. 38
  38. Lu, M., S. Menne, D. Yang, Y. Xu, and M. Roggendorf. 2007. Immunomodulation as an option for the treatment of chronic hepatitis B virus infection: preclinical studies in the woodchuck model. Expert. Opin. Investig. Drugs 16:787-801.[CrossRef][Medline]
    39. 39
  39. Machin, D., Y. B. Cheung, and M. K. B. Parmar. 2006. Survival analysis: a practical approach. John Wiley & Sons, Ltd., Chicester, West Sussex, United Kingdom.
    40. 40
  40. Maitta, R. W., K. Datta, Q. Chang, R. X. Luo, B. Witover, K. S. Subramaniam, and L. A. Pirofski. 2004. Protective and nonprotective human IgM monoclonal antibodies to Cryptococcus neoformans glucuronoxylomannan manifest different specificities and gene use profiles. Infect. Immun. 72:4810-4818.[Abstract/Free Full Text]
    41. 41
  41. Maitta, R. W., K. Datta, A. Lees, S. S. Belouski, and L. A. Pirofski. 2004. Immunogenicity and efficacy of Cryptococcus neoformans capsular polysaccharide glucuronoxylomannan peptide mimotope-protein conjugates in human immunoglobulin transgenic mice. Infect. Immun. 72:196-208.[Abstract/Free Full Text]
    42. 42
  42. Maitta, R. W., K. Datta, and L. A. Pirofski. 2004. Efficacy of immune sera from human immunoglobulin transgenic mice immunized with a peptide mimotope of Cryptococcus neoformans glucuronoxylomannan. Vaccine 22:4062-4068.[CrossRef][Medline]
    43. 43
  43. Marroni, M., E. Pericolini, E. Cenci, F. Bistoni, and A. Vecchiarelli. 2007. Functional defect of natural immune system in an apparent immunocompetent patient with pulmonary cryptococcosis. J. Infect. 54:e5-e8.[CrossRef][Medline]
    44. 44
  44. May, R. J., D. O. Beenhouwer, and M. D. Scharff. 2003. Antibodies to keyhole limpet hemocyanin cross-react with an epitope on the polysaccharide capsule of Cryptococcus neoformans and other carbohydrates: implications for vaccine development. J. Immunol. 171:4905-4912.[Abstract/Free Full Text]
    45. 45
  45. Mays, S. R., M. A. Bogle, and G. P. Bodey. 2006. Cutaneous fungal infections in the oncology patient: recognition and management. Am. J. Clin. Dermatol. 7:31-43.[CrossRef][Medline]
    46. 46
  46. Monari, C., T. R. Kozel, F. Paganelli, E. Pericolini, S. Perito, F. Bistoni, A. Casadevall, and A. Vecchiarelli. 2006. Microbial immune suppression mediated by direct engagement of inhibitory Fc receptor. J. Immunol. 177:6842-6851.[Abstract/Free Full Text]
    47. 47
  47. Mukherjee, J., T. R. Kozel, and A. Casadevall. 1998. Monoclonal antibodies reveal additional epitopes of serotype D Cryptococcus neoformans capsular glucuronoxylomannan that elicit protective antibodies. J. Immunol. 161:3557-3567.[Abstract/Free Full Text]
    48. 48
  48. Nussbaum, G., W. Cleare, A. Casadevall, M. D. Scharff, and P. Valadon. 1997. Epitope location in the Cryptococcus neoformans capsule is a determinant of antibody efficacy. J. Exp. Med. 185:685-694.[Abstract/Free Full Text]
    49. 49
  49. Pagano, L., M. Caira, and L. Fianchi. 2005. Pulmonary fungal infection with yeasts and pneumocystis in patients with hematological malignancy. Ann. Med. 37:259-269.[CrossRef][Medline]
    50. 50
  50. Perfect, J. R., and A. Casadevall. 2002. Cryptococcosis. Infect. Dis. Clin. N. Am. 16:837-838.[CrossRef][Medline]
    51. 51
  51. Pirofski, L. A. 2001. Polysaccharides, mimotopes and vaccines for fungal and encapsulated pathogens. Trends Microbiol. 9:445-451.[CrossRef][Medline]
    52. 52
  52. Powderly, W. G. 2000. Current approach to the acute management of cryptococcal infections. J. Infect. 41:18-22.[CrossRef][Medline]
    53. 53
  53. Rivera, J., and A. Casadevall. 2005. Mouse genetic background is a major determinant of isotype-related differences for antibody-mediated protective efficacy against Cryptococcus neoformans. J. Immunol. 174:8017-8026.[Abstract/Free Full Text]
    54. 54
  54. Romani, L., and S. H. Kaufmann. 1998. Immunity to fungi: editorial overview. Res. Immunol. 149:277-281.[CrossRef][Medline]
    55. 55
  55. Saha, D. C., D. L. Goldman, X. Shao, A. Casadevall, S. Husain, A. P. Limaye, M. Lyon, J. Somani, K. Pursell, T. L. Pruett, and N. Singh. 2007. Serologic evidence for reactivation of cryptococcosis in solid-organ transplant recipients. Clin. Vaccine Immunol. 14:1550-1554.[Abstract/Free Full Text]
    56. 56
  56. Segal, B. H., E. J. Bow, and F. Menichetti. 2002. Fungal infections in nontransplant patients with hematologic malignancies. Infect. Dis. Clin. N. Am. 16:935-964.[CrossRef][Medline]
    57. 57
  57. Sigurdardottir, S. T., G. Ingolfsdottir, K. Davidsdottir, T. Gudnason, S. Kjartansson, K. G. Kristinsson, F. Bailleux, O. Leroy, and I. Jonsdottir. 2002. Immune response to octavalent diphtheria- and tetanus-conjugated pneumococcal vaccines is serotype- and carrier-specific: the choice for a mixed carrier vaccine. Pediatr. Infect. Dis. J. 21:548-554.[CrossRef][Medline]
    58. 58
  58. Singh, N., B. D. Alexander, O. Lortholary, F. Dromer, K. L. Gupta, G. T. John, B. R. del, G. B. Klintmalm, J. Somani, G. M. Lyon, K. Pursell, V. Stosor, P. Munoz, A. P. Limaye, A. C. Kalil, T. L. Pruett, J. Garcia-Diaz, A. Humar, S. Houston, A. A. House, D. Wray, S. Orloff, L. A. Dowdy, R. A. Fisher, J. Heitman, M. M. Wagener, and S. Husain. 2008. Pulmonary cryptococcosis in solid organ transplant recipients: clinical relevance of serum cryptococcal antigen. Clin. Infect. Dis. 46:e12-e18.[Medline]
    59. 59
  59. Singh, N., O. Lortholary, B. D. Alexander, K. L. Gupta, G. T. John, K. Pursell, P. Munoz, G. B. Klintmalm, V. Stosor, R. del Busto, A. P. Limaye, J. Somani, M. Lyon, S. Houston, A. A. House, T. L. Pruett, S. Orloff, A. Humar, L. Dowdy, J. Garcia-Diaz, A. C. Kalil, R. A. Fisher, and S. Husain. 2005. An immune reconstitution syndrome-like illness associated with Cryptococcus neoformans infection in organ transplant recipients. Clin. Infect. Dis. 40:1756-1761.[CrossRef][Medline]
    60. 60
  60. Snelgrove, R. J., L. Edwards, A. E. Williams, A. J. Rae, and T. Hussell. 2006. In the absence of reactive oxygen species, T cells default to a Th1 phenotype and mediate protection against pulmonary Cryptococcus neoformans infection. J. Immunol. 177:5509-5516.[Abstract/Free Full Text]
    61. 61
  61. Spitzer, E. D., S. G. Spitzer, L. F. Freundlich, and A. Casadevall. 1993. Persistence of initial infection in recurrent Cryptococcus neoformans meningitis. Lancet 341:595-596.[CrossRef][Medline]
    62. 62
  62. Uicker, W. C., J. P. McCracken, and K. L. Buchanan. 2006. Role of CD4+ T cells in a protective immune response against Cryptococcus neoformans in the central nervous system. Med. Mycol. 44:1-11.[Medline]
    63. 63
  63. Vilchez, R. A., J. Fung, and S. Kusne. 2002. Cryptococcosis in organ transplant recipients: an overview. Am. J. Transplant. 2:575-580.[CrossRef][Medline]
    64. 64
  64. Waters, L., and M. Nelson. 2005. Cryptococcal disease and HIV infection. Expert. Opin. Pharmacother. 6:2633-2644.[CrossRef][Medline]
    65. 65
  65. Xu, Q. H., X. N. Zhao, J. P. Cheng, C. H. Wei, Q. H. Zhang, and K. T. Rong. 2006. Influence of carrier proteins on the immunologic response to haptenic antitetrodotoxin vaccine. Bioconjug. Chem. 17:1508-1513.[CrossRef][Medline]
    66. 66
  66. Yauch, L. E., M. K. Mansour, and S. M. Levitz. 2005. Receptor-mediated clearance of Cryptococcus neoformans capsular polysaccharide in vivo. Infect. Immun. 73:8429-8432.[Abstract/Free Full Text]
    67. 67
  67. Zhang, H., Z. Zhong, and L. A. Pirofski. 1997. Peptide epitopes recognized by a human anti-cryptococcal glucuronoxylomannan antibody. Infect. Immun. 65:1158-1164.[Abstract]
    68. 68
  68. Zhou, Q., R. A. Gault, T. R. Kozel, and W. J. Murphy. 2007. Protection from direct cerebral cryptococcus infection by interferon-gamma-dependent activation of microglial cells. J. Immunol. 178:5753-5761.[Abstract/Free Full Text]

Clinical and Vaccine Immunology, August 2008, p. 1176-1187, Vol. 15, No. 8
1071-412X/08/$08.00+0     doi:10.1128/CVI.00130-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Datta, K.
Right arrow Articles by Pirofski, L.-a.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Datta, K.
Right arrow Articles by Pirofski, L.-a.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»