Previous Article | Next Article ![]()
Clinical and Vaccine Immunology, February 2008, p. 215-220, Vol. 15, No. 2
1071-412X/08/$08.00+0 doi:10.1128/CVI.00283-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India,1 Department of Pediatrics, All India Institute of Medical Sciences, New Delhi, India,2 International Center for Genetic Engineering and Biotechnology, New Delhi, India3
Received 2 July 2007/ Returned for modification 6 September 2007/ Accepted 7 November 2007
|
|
|---|
|
|
|---|
M. pneumoniae has a complex cellular organization and possess a specialized tip organelle, a membrane-bound cell extension distinguished by an electron-dense core (2, 4). The well-defined apical organelle mediates adherence to host cells (cytadherence) and gliding motility (6). Analysis of an M. pneumoniae hemadsorption (HA)-negative mutant has resulted in the identification of a number of proteins associated with cytadherence, such as P1, P30, P116, and HMW 1 to 3 (3, 11, 16, 18). These proteins are localized on the apical organelle, which is the leading end in the gliding motility. Among these organelle-associated genes, P30 is required for cytadherence and is associated with proper cell development (19). M. pneumoniae mutant M7, which exhibited a truncated P30 protein, had lost the ability to adsorb to erythrocytes and to bind to epithelial cells (17). P30 has also been shown to be associated with gliding motility. M. pneumoniae HA mutant II-3, which lacks the P30 protein, has been shown to be nonmotile, while HA mutant II-7, which produces an altered P30 protein, showed 50-fold less motility than that of the wild type (12, 13).
The p30 gene contains an open reading frame of 825 nucleotides that codes for a protein of 275 amino acids with a calculated molecular mass of 29.743 kDa. The gene has only one UGA codon (nucleotides 46 to 48), which codes for tryptophan in the case of M. pneumoniae (8). P30 is a membrane-bound protein that orients with the N terminus in the cytoplasm and the C terminus exposed on the cell surface. The protein contains three types of repeat sequences at its carboxy end. One stretch of Pro-Gly-Met-Ala-Pro-Arg occurs seven times, whereas two stretches of Pro-Gly-Met-Pro-Pro-His and Pro-Gly-Phe-Pro-Pro-Gln are repeated three times. On the basis of the orientation of the protein, it is envisaged that the C terminus of the P30 protein is exposed on the surface of M. pneumoniae. It is likely to generate an immune response in M. pneumoniae-infected patient sera and thus can be exploited for the immunodetection of M. pneumoniae-infected human sera.
In the present study, we sequenced the full-length p30 gene of M. pneumoniae directly from 18 clinical samples (throat swabs) from asthma patients attending a pediatric asthma clinic at the All India Institute of Medical Sciences (AIIMS), New Delhi, India. We also analyzed the reactivity of P30 with M. pneumoniae-infected patient sera.
(This work is a part of the Ph.D. thesis work of Avanish Kumar Varshney under the supervision of Rama Chaudhry at the All India Institute of Medical Sciences, New Delhi, India.)
|
|
|---|
Study group. A total of 150 patients between 5 and 15 years of age who had previously been diagnosed with moderate or severe persistent asthma (1) and who were attending the Pediatric Chest Clinic, AIIMS, during the period from November 2004 to May 2006 were investigated. The study was approved by the AIIMS Ethical Committee for Human and Animal Ethical Clearance, and the consent of the patients' parents was obtained before the children were included in the study. Blood was collected intravenously and placed in a plain sterile tube. The serum was separated by centrifugation at 3,000 rpm for 10 min and was stored at –20°C until use. Throat swab specimens were collected from the study group and were transported in PPLO broth medium for M. pneumoniae culture and PCR.
PCR amplification of the p30 gene of M. pneumoniae. Throat swabs from the infected patients were inoculated and incubated at 37°C in PPLO broth for 24 h, and DNA extraction was carried out by the method previously described by Stauffer et al. (21). Likewise, the standard strain was grown in PPLO broth for 72 h, and the DNA was extracted accordingly. The extracted DNA was stored at –20°C until use.
On the basis of the sequences available in the database, oligonucleotide primers were designed to amplify the p30 gene from the M. pneumoniae genomic DNA (8). Primers P30-PF (forward primer; 5'-ATGAAGTTACCACCTCGAAGAAGC-3') and P30-PR (reverse primer; 5'-TTAGCGTTTTGGTGGAAAACCGGGTTG-3') were used for the amplification of the p30 gene (Synthesized from Bio Basic, Canada). PCR was performed in a 50-µl reaction mixture containing 1 U of Taq polymerase, 1x PCR buffer, 200 µM deoxynucleoside triphosphates, 1.5 mM MgCl2, 10 pmol of each primer, and 6 µl of extracted DNA. The reaction conditions were standardized at an initial denaturation of 94°C for 10 min, followed by 35 cycles of 94°C for 30 s, 54°C for 45 s, and 72°C for 1 min 20 s. A final extension was done at 72°C for 10 min. The PCR products were analyzed in a 1.2% agarose gel and purified with a gel extraction kit (Qiagen, Hilden, Germany). The amplified product was further cloned in the pGEMT-E vector. For the expression of the p30 gene and its fragment in heterologous expression systems (pQE-30), the following primer set was synthesized: forward primer P30-EF1 (5'-CCATGGGACCATGAAGTTACCACCTCGAAGAAAGCTTAAACTGTTTTTATTAGCCTGGATG-3') and reverse primer P30-ER1 (5'- GTCGACTGCAGCGTTTTGGTGGAAA ACCGGGTTG-3'). For the expression of the p30 gene (P30B) fragment in a pMAL-p2x vector system, forward primer P30-EF2 (5'-CCATGGGATCCGCAACCTTAATTTTGGTACAGCAC-3') and reverse P30-ER1 primer were used (Fig. 1). Note that the expression primer, P30-EF2, was designed to exclude the UGA codon region of the p30 gene of M. pneumoniae.
|
View larger version (7K): [in a new window] |
FIG. 1. Schematic diagram showing the primers used for amplification of the p30 gene and fragments for expression.
|
The nucleotide sequences of the p30 gene amplified from the clinical samples were compared with the p30 sequence of M. pneumoniae strain M129 (GenBank accession no. M57245). Sequence analysis was performed with the Clustal W and Gene Doc tools, and protein translation was done with the EditSeq tool of DNAStar software (DNAStar Inc., Madison, WI) by using the Mycoplasma coding table.
Cloning and expression of p30 gene and its fragment of M. pneumoniae.
The amplified and purified DNA fragment was ligated into the pGEMT-E vector system (Promega, Madison, WI), according to the manufacturer's protocol. Briefly, a 10-µl reaction mixture was set up with 10 ng vector DNA, 5.0 µl of ligation buffer (2x), 1.0 µl T4 DNA ligase (1 U), and 3 µl of the PCR-amplified product (insert DNA, 300 ng). The ligation reaction mixture was incubated at 4°C for 16 h and was transformed into chemically competent DH5
cells.
Colonies were selected by blue-white selection screening on Luria-Bertani (LB) agar containing 100 µg/ml of ampicillin, 20 mg of 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, and 200 mg/ml of isopropyl-β-D-thiogalactopyranoside (IPTG) (Sigma). Individual white colonies from the plate were inoculated in 5 ml LB broth containing 100 µg/ml of ampicillin and were allowed to grow for 16 h at 37°C. Plasmids were extracted with a Qiagen mini-prep plasmid extraction kit and digested with EcoRI to ensure the presence of the insert, and sequencing was done to rule out any mutation in the sequence.
For expression, subcloning of the full-length P30 protein (P30A) and a fragment of the p30 gene (P30B) was done in the pQE-30 vector and the pMAL-p2x fusion vector, according to the manufacturer's instructions, with some modifications (Fig. 1). Briefly, the pGEMT-E construct of the p30 gene was digested with the BamHI and SalI restriction endonucleases, and the digestion mixture was separated on a 1% agarose gel. The full-length P30 protein (825 bp) and the fragment corresponding to the p30 gene (744 bp) were excised, and DNA was eluted by using a gel extraction kit (Real Biotech Corporation, Germany). The pQE-30 and pMAL-p2x vectors were also digested with the same restriction endonucleases used to digest the insert. The digested vectors and insert were ligated at 16°C overnight. The ligation mixtures were transformed into Escherichia coli M-15 cells (for the pQE-30 vector) and E. coli TB-1 cells (for the pMAL-p2x vector). Transformants were selected on LB agar plates containing 100 µg/ml ampicillin and 25 µg/ml of kanamycin for the pQE-30 vector and 100 µg/ml ampicillin for the pMAL-p2x fusion vector. The recombinants were screened by restriction digestion and sequencing.
M-15 cells and TB-1 cells containing the recombinant plasmids were cultivated in 5 ml of LB broth at 37°C with shaking until the optical density (OD) reached 0.4 to 0.6. Expression was induced by treatment with 1 mM IPTG for 5 h at 37°C. Bacterial cells were collected by centrifugation and were further subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) to analyze the expression of the recombinant proteins.
SDS-PAGE and Western blotting. The crude induced and uninduced lysates of the samples were dissolved in 30 µl of SDS sample buffer (62.5 mM Tris-HCl [pH 6.8], 10% glycerol, 2.3% [wt/vol] SDS, 5% [vol/vol] β-mercaptoethanol, and 0.05% [wt/vol] bromophenol blue) and boiled for 10 min. The proteins were resolved on a 10% SDS-polyacrylamide gel and stained with Coomassie brilliant blue R-250. For immunoblotting, the protein was separated on a 10% SDS-polyacrylamide gel, and the fractionated proteins were transferred from the gel onto the nitrocellulose membrane (Amersham) in a Transblot apparatus (Mini Protein III; Bio-Rad). The membrane was blocked in blocking buffer (1x phosphate-buffered saline [PBS], 0.05% Tween 20, 5% milk) for 2 h. The blots were washed and incubated with primary antibody for 1 h: anti-His (1:5,000 dilution; Qiagen), anti-maltose binding protein (anti-MBP) antibody (1:5,000 dilution; New England Biolabs), anti-M. pneumoniae antibody (1:5,000 dilution; National Collection of Type Cultures), and patient sera (1:100 dilution). Later, the blots were washed and incubated for 1 h with secondary antibody (1:2,000 dilutions of anti-mouse, anti-rabbit, or anti-human antibody) conjugated to horseradish peroxidase. The bands were visualized with 3,3'-diaminobenzidine tetrahydrochloride-H2O2 (Sigma-Aldrich).
Purification of recombinant proteins. After confirmation of the recombinant protein by Western blotting, the rMPN30-pQE-30 recombinant protein was purified by using a nickel-nitriloacetic acid column (Qiagen) and the rMPN30-pMAL-p2x recombinant protein was purified on an amylose resin column (New England Biolabs). For large-scale production, cells expressing the P30 protein were grown in a 100-ml culture and were induced with 1 mM IPTG. The bacterial cells were then harvested by centrifugation at 5,000 x g, and the pellets were resuspended in a buffer consisting of 10 mM Tris (pH 7.5) and 50 mM NaCl and lysed by sonication with 1-min pulses at 1-min intervals 10 times. The soluble and insoluble fractions were separated by centrifugation at 20,000 x g and were analyzed by SDS-PAGE.
The recombinant P30B protein (rMPN30-pQE-30) was purified under denaturing conditions by metal affinity chromatography with nickel-nitriloacetic acid resin (Qiagen). Elutions were carried out with imidazole buffer (8 M urea, 20 mM Na2HPO4, 5 M NaCl, 500 mM imidazole). The protein was dialyzed in dialysis buffer containing 50 mM Tris and 1 mM EDTA for 48 h, with buffer changes every 12 h to remove the urea and imidazole. The purity of the recombinant protein was evaluated by SDS-PAGE.
Another recombinant P30B protein (rMPN30-pMAL-p2x) was purified under soluble conditions by using affinity chromatography with amylose resin (New England Biolabs), according to the manufacturer's protocol, with some modifications. Elutions were carried out with maltose buffer (10 mM maltose, 10 mM Tris, and 500 mM NaCl). Fractions containing the purified recombinant protein were pooled and dialyzed against PBS. The column eluent containing rMPN30-pMAL-p2x was concentrated by centrifugation with Centricon-30 concentrators (Amicon Inc., Beverly, MA). The concentrated rMPN30-pMAL-p2x protein was run on an SDS-polyacrylamide gel stained with Coomassie blue R-250, and the desired protein band was excised from the gel with a sterile razor blade and electroeluted by using a GeBAflex-tube kit (Gene Bio-Application Ltd., Israel). The protein concentration was determined by the Bradford method.
Immunization of mice. All animal experiments were carried out with the approval of the Animal Ethics Committee, in accordance with the rules and regulations set forth by the AIIMS Animal Ethics Committee. Immunization was carried out with 6- to 8-week-old female Swiss albino mice, which were maintained in the animal facility of AIIMS. The Swiss albino mice were administered 40 µg MBP-P30B fusion protein emulsified in 200 µl of complete Freund's adjuvant (CFA; Sigma) intraperitoneally. Subsequent booster injections were given on the 21st, 35th, and 49th days by injecting 40 µg of the MBP-P30B fusion protein emulsified in 200 µl of incomplete Freund's adjuvant (IFA; Sigma) intraperitoneally. Control mice were injected with CFA and IFA in PBS according to the immunization schedule. Blood samples were obtained from each mouse by bleeding of the tail vein at 14, 21, 35, 42, and 56 days. The serum was separated by centrifugation of clotted blood and was stored at –20°C for further analysis. The titers of antibodies against the recombinant protein were determined by enzyme-linked immunosorbent assay (ELISA).
Comparative ELISA with purified P30 fusion protein and commercial IgM assay. Serum was separated by centrifugation of clotted blood from patients at 3,000 rpm for 10 min and was subjected to an immunoglobulin M (IgM) ELISA (ELISA Classic; Serion, Germany) for the detection of anti-M. pneumoniae antibodies. A total of 47 patient serum samples (28 positive and 19 negative patient serum samples tested for the investigation of M. pneumoniae with the commercial Serion ELISA Classic kit) were included in this study. Due to inadequate sample volumes, the remaining 103 specimens could not be tested for P30 antibodies. MBP and the alpha subunit of the beta-galactosidase protein were used as negative controls in the ELISA experiments.
The antibody response to the recombinant fusion protein (rMPN30-pMAL-p2x) was evaluated by an ELISA for IgM antibodies. The experiment was done in duplicate. A total of 100 µl of coating buffer (0.1 M bicarbonate, pH 9.3) containing 100 ng of the P30 protein was added to 96-well microtiter plates, and the plates were incubated overnight at 4°C. The plates were then washed with PBS-0.05% Tween 20 (PBS-T) and blocked with 5% bovine serum albumin in PBS (pH 7.4) for 2 h. The plates were washed twice with PBS-T and once with PBS and were then incubated with the individual patient sera (1:100 dilution) at 37°C for 1 h. The wells were washed and then incubated with horseradish peroxidase-conjugated anti-human IgM (Sigma) diluted 1:3,000 in PBS-T for 1 h at 37°C. The plates were washed three times with PBS-T, and the color was developed by adding 100 µl of 3,3',5,5'-tetramethylbenzidine-H2O2 substrate (Banglore Genei, India) and incubation in the dark for 20 min. The reaction was stopped by adding 100 µl of 2 N H2SO4, and the absorbance was read at a wavelength of 450 nm with an ELISA reader (Bio-Tek Microplate reader). The sample was considered positive if the OD at 450 nm was >0.5.
Statistical analysis. Data management was done on an Excel spreadsheet. All entries were checked for any keyboard errors. The sensitivity and the specificity of the in-house P30 ELISA were calculated by using Epi-6 software.
Nucleotide sequence accession number. The sequence presented in this study has been submitted to the NCBI GenBank database and can be found under accession no. EF 614306.
|
|
|---|
![]() View larger version (35K): [in a new window] |
FIG. 2. Amino acid sequence variations among 18 clinical samples. Sam. No., sample number.
|
![]() View larger version (48K): [in a new window] |
FIG. 3. (A) SDS-polyacrylamide gel showing the purification of the P30 protein from E. coli extracts. Lanes: 1, initial flowthrough; 2, wash 1; 3, elution 1; 4, elution 2. (B and C) Western blots of E. coli extracts showing the expression of the P30 protein with antihistidine antibody (B) and anti-M. pneumoniae antibodies (C). Lanes: 1, prestained protein marker; 2, uninduced P30 protein; 3, induced P30 protein. The numbers on the left are molecular masses (in kilodaltons).
|
80% (Fig. 4B). To further purify the protein to homogeneity, the rMPN30-pMAL-p2x fusion protein was run on a 10% SDS- polyacrylamide gel, and the gel was stained with Coomassie blue R-250. The major band pertaining to the MBP-P30 fusion protein was cut and electroeluted from the gel. Figure 4 shows the Coomassie blue-stained SDS-polyacrylamide gels of the eluted P30 protein. The purified protein was recognized well by anti-M. pneumoniae antibodies (Fig. 4D).
![]() View larger version (39K): [in a new window] |
FIG. 4. (A) Western blot of E. coli extracts showing the expression of the P30 protein with anti-MBP antibody. Lanes: 1, prestained protein marker; 2, induced P30 protein; 3, uninduced P30 protein. (B) SDS-polyacrylamide gel showing the purification of the P30 fusion protein. Lanes: 1, marker; 2, initial flowthrough; 3, wash 1; 4, wash 2; 5, elution 1; 6, elution 2. (C) Electroelution of the P30 protein from the purified MBP fusion construct, Lanes: 1, standard protein marker; 2 and 3, eluted P30 fusion protein. (D) Western blot of E. coli extracts showing the expression of the P30 protein with anti-M. pneumoniae antibodies. Lanes: 1, prestained protein marker; 2 and 3, induced P30 protein. The numbers on the left are molecular masses (in kilodaltons).
|
|
View larger version (17K): [in a new window] |
FIG. 5. Immunoblot of the purified P30 fusion protein with individual positive and negative patient serum samples and anti-MBP antibodies. Lanes 7, 10, 24, 40, 73, and 113, individual positive serum samples; lanes 29 and 101, negative controls (negative individual serum samples that tested negative with the commercial kit). Lane PM, P30 fusion protein reacted with anti-MBP antibodies.
|
![]() View larger version (21K): [in a new window] |
FIG. 6. Immune response in BALB/c mice immunized with the P30B-MBP fusion protein formulated in CFA or IFA.
|
![]() View larger version (28K): [in a new window] |
FIG. 7. Comparative ELISA analysis by the recombinant P30 ELISA and with the Serion Classic IgM ELISA kit with sera from 47 patients. (A) Positive patient sera. (B) Negative patient sera.
|
|
|
|---|
Since M. pneumoniae is an organism that is difficult to isolate and grow, standard methods for the detection of M. pneumoniae are serology and PCR. Serological methods are presently based on the total cell lysate, which sometimes shows cross-reactivity with other mycoplasmas and microorganisms. Our group has been interested in developing protocols to produce large amounts of M. pneumoniae surface antigens. In the present study, we expressed a fragment of the p30 gene that includes the complete C-terminal proline-rich amino acid sequences. The protein was expressed as a His-tagged and MBP-P30 fusion protein; however, we failed to obtain the His-tagged P30 protein in soluble form under nondenaturing conditions. Nonetheless, we were able to express and purify the MBP-P30 fusion protein in soluble form. The yield of purified protein was approximately 1 mg/liter. The purified protein was recognized by anti-M. pneumoniae antibodies. Although the P30 protein has previously been expressed in an E. coli expression vector as well as in Bacillus subtilis, it appears that the protein was expressed in very small amounts (15, 17).
Previous studies of the P30 protein have mainly been focused on understanding its role in cytadherence and gliding motility (9, 11, 16, 19). Its use as an immunodiagnostic molecule has not been explored. As the C-terminal proline-rich fragment of P30 is exposed on the surface of M. pneumoniae, we carried out a detailed immunological analysis of the rMPN30-pMAL-p2x fusion protein. The fusion protein was immunogenic, as it elicited a boostable immune response in mice. The protein was recognized by M. pneumoniae-infected patient sera as well. We next analyzed the reactivity of the rMPN30-pMAL-p2x fusion protein with patient sera in an ELISA analysis and compared the reactivity with that obtained with the Serion ELISA Classic kit. This kit has been reported to be 100% sensitive and 75% specific, as described in the manufacturer's instructions. The sensitivity and the specificity of our ELISA with the purified MBP-P30B fusion protein were found to be 78.57% and 89.47%, respectively.
In conclusion, the results from the present study indicate that the P30 protein is an important antigen and can be used along with two other adhesin molecules, P1 and P116, for the development of a sensitive assay for the diagnosis of M. pneumoniae infection. The use of this protein to study cytadherence may also provide insight into the pathophysiology of this disease.
Published ahead of print on 21 November 2007. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»