Previous Article | Next Article ![]()
Clinical and Vaccine Immunology, March 2007, p. 262-268, Vol. 14, No. 3
1071-412X/07/$08.00+0 doi:10.1128/CVI.00320-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

N. Luckschander,2
S. Wong,3
F. Chu,3
J. E. Foley,4
A. Bjoersdorff,5
S. Stuen,6 and
D. P. Knowles7
College of Veterinary Medicine, University of Florida, Gainesville, Florida,1 Vetsuisse Faculty, University of Bern, Bern, Switzerland,2 Wadsworth Center, New York State Department of Health, Albany, New York,3 Department of Medicine and Epidemiology, University of California, Davis, California,4 Department of Clinical Microbiology, Kalmar County Hospital, Kalmar, Sweden,5 Department of Sheep and Goat Research, Norwegian School of Veterinary Science, Sandnes, Norway,6 Animal Disease Research Unit, Agricultural Research Service, USDA, and Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, Washington7
Received 1 September 2006/ Returned for modification 16 October 2006/ Accepted 2 January 2007
|
|
|---|
|
|
|---|
A. phagocytophilum has been detected worldwide, particularly in North America and Europe as well as in South Africa, South America, and Asia; it infects humans, horses, ruminants, cats, dogs, and a variety of wildlife species, including rodents, deer, and carnivores (4, 9, 12, 14, 15, 16, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 33, 34, 36, 39, 40, 41, 42). Clinical signs of infection, although differing with the species of host and the virulence, include fever, anorexia, anemia, thrombocytopenia, leukopenia, neurological signs, hepatic inflammation, abortions, and even fatalities in a small percentage of mammalian hosts. Current serologic diagnosis is most often based on an indirect immunofluorescent antibody (IFA) test that uses whole, cultured organisms as a test antigen.
The serologic diagnosis of Anaplasma marginale infection is based on a commercially available competitive inhibition enzyme-linked immunosorbent assay (cELISA) developed in the mid-1990s (17, 38). This highly sensitive and specific assay uses recombinant Msp5 (rMsp5) as a diagnostic antigen, along with horseradish peroxidase (HRP)-conjugated monoclonal antibody ANAF16C1, which binds to an epitope specific for Msp5 of A. marginale (37).
Even before the recent reclassification within the family Anaplasmataceae, the msp5 gene was known to be highly conserved among all Anaplasma species, which, at that time, included A. marginale, A. centrale, and A. ovis (17). Based on 16S rRNA gene sequence similarity, A. phagocytophilum and A. platys were placed within the same family (11).
In this study, we investigate the conservation of the msp5 gene among various geographic isolates of A. phagocytophilum through cloning and sequencing of msp5, and we examine the level of cross-reactivity and the potential value of rMsp5 orthologs of A. phagocytophilum and A. marginale as test antigens for serodiagnosis of anaplasmosis.
|
|
|---|
Amplification of the msp5 gene of A. phagocytophilum. Primers which corresponded to the sequences encoding the predicted translated and processed proteins of the msp5 gene were synthesized by Genosys Biotechnologies Inc., The Woodlands, TX. Forward primer ARA28 (5' ACTGTGTTTCTGGGGTATTCGTATGTTAAC 3') and reverse primer ARA29 (5' AGAATTAAGGTACTTATTAACGAAATCAAA 3') were designed for in-frame insertion of amplicons into the pTrcHis2-TOPO vector (Invitrogen Corporation, Carlsbad, CA). The N terminus of the mature protein, without the peptide signal sequence, corresponds to nucleotide 46 of the open reading frame. Amplification was performed using Pfu DNA polymerase (Stratagene, La Jolla, CA). Briefly, 10 ng/µl of genomic DNA was amplified using 0.5 µM each of primers ARA28 and ARA29 and 1.00 U of Pfu polymerase in 5 mM deoxynucleoside triphosphates, 10 mM Tris-HCl (pH 8.8), 50 mM KCl, and 1.5 mM MgCl2. PCR assays were performed at 94°C for 3 min, followed by 10 cycles of denaturing at 94°C for 15 s, annealing at 43°C for 1 min, and extension at 72°C for 2 min. This was followed by 25 cycles of denaturing at 94°C for 15 s, annealing at 49°C for 1 min, and extension at 72°C for 2 min. A final extension step at 72°C was performed for 7 min. Amplicons were analyzed by gel electrophoresis on a 1% agarose gel in 1x TBE buffer (89 mM Tris, 89 mM boric acid, and 2 mM disodium EDTA).
Cloning and sequencing of A. phagocytophilum msp5. Amplicons were incubated at 72°C for 10 min in 1.0 U of Taq DNA polymerase in order to produce amplicons with the 3' A overhangs needed for ligation into the TOPO vector inserted into the pTrcHis2-TOPO vector (Invitrogen Corporation). Cloning was performed according to the manufacturer's recommendations. Recombinant plasmids were transformed into Escherichia coli (One Shot cells; Invitrogen Corporation), and transformants were grown on Luria-Bertani (LB) agar plates in the presence of ampicillin (50 µg/ml). Colonies were selected and incubated in LB broth in the presence of ampicillin (50 µg/ml) overnight at 37°C with vigorous shaking. Plasmid DNA was extracted by a rapid miniprep method (43), reconstituted in Tris-EDTA buffer (pH 8.0) containing 1.0 µg/ml of DNase-free RNase, and analyzed on a 1% agarose gel. Recombinant clones containing the msp5 orthologs of A. phagocytophilum were digested with restriction enzyme EcoRI to ensure the correct orientation of the insert in the plasmid vector. Digested DNA was analyzed on a 1% agarose gel. The DNA sequences of both strands of the 582-bp insert of pTrcHis2-TOPO K1 were determined by the DNA Sequencing Core Laboratory at the University of Florida, Gainesville, FL. The DNA sequences of the msp5 genes from various geographic isolates from A. phagocytophilum were determined for both strands, using forward and reverse primers based on vector sequences in flanking regions. DNA sequences were compared by Seqweb (Genetics Computer Group, Madison, WI).
A. phagocytophilum recombinant Msp5 production and purification. Transformed cells containing the msp5 gene ortholog of A. phagocytophilum were incubated with vigorous shaking at 37°C in Luria-Bertani broth containing 50 µg/ml ampicillin overnight. A tenfold dilution of this overnight culture was added to Terrific Broth medium (32) containing 500 mM glycylglycine (13) and incubated with vigorous shaking to an optical density at 600 nm of 1.0. Protein production was induced with 0.5 mM isopropyl-ß-D-thiogalactopyranoside. Cells were incubated with vigorous shaking at 27°C for an additional 16 h. Recombinant proteins were purified by immobilized metal affinity chromatography (ProBond resin; Invitrogen Corporation) and isolated under native, nondenaturing conditions, using solutions with pH levels of 7.8, 6.0, and 5.5 and eluting at pH 4.0, according to the manufacturer's recommendations. Fractions containing the rMsp5 ortholog were identified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and staining with Coomassie blue. The rMsp5 protein contained a C-terminal polyhistidine tag for purification by affinity chromatography and a C-terminal Myc tag for protein identification in immunoblot assays. The authenticity of the rMsp5 ortholog of A. phagocytophilum was evaluated by Western immunoblot analysis using an HRP-conjugated anti-Myc antibody (Invitrogen Corporation) and pre- and postinoculation sera from a dog experimentally infected with A. phagocytophilum.
Antibodies and antisera. Monoclonal antibody ANAF16C1 (cELISA anaplasma antibody test kit; VMRD, Pullman, WA) was used as a positive control for the A. marginale rMsp5 ortholog in immunoblot assays. WAT24A1, a monoclonal antibody against trypanosome surface antigen, was used as a negative control in immunoblot assays and in an indirect ELISA with rMsp5 of A. phagocytophilum and rMsp5 of A. marginale. Horseradish peroxidase-labeled anti-Myc antibody (anti-Myc [C-terminal]-HRP; Invitrogen Corporation) was used as a positive control for the A. phagocytophilum rMsp5 ortholog in immunoblot assays.
Alkaline phosphatase-conjugated rabbit anti-dog immunoglobulin G (whole molecule; Sigma Chemical Co., St. Louis, MO), alkaline phosphatase-conjugated goat anti-human immunoglobulin G and immunoglobulin M (whole molecule; Jackson ImmunoResearch Laboratories, West Grove, PA), alkaline phosphatase-conjugated rabbit anti-bovine immunoglobulin G (whole molecule; Sigma Chemical Co.), and alkaline phosphatase-conjugated rabbit anti-mouse immunoglobulin G (whole molecule; Sigma Chemical Co.) were used as secondary antibodies in indirect ELISAs.
Twenty pre- and postinfection serum samples were collected from 0 to 94 days from each of two dogs experimentally infected with the NY18 strain of A. phagocytophilum (3). In addition, five serum samples from dogs naturally infected with A. phagocytophilum (one from the University of Florida and four from the Vetsuisse Faculty of Berne, Switzerland) were evaluated for antibodies to rMsp5 of A. phagocytophilum and A. marginale. Nine postinfection serum samples from three dogs experimentally infected with a Swedish isolate of A. phagocytophilum were tested for antibodies to rMsp5 of A. phagocytophilum, using an indirect ELISA.
Seventeen serum samples from dogs naturally infected with Ehrlichia canis and 10 serum samples from dogs naturally infected with Anaplasma platys were tested for antibodies to rMsp5 of A. phagocytophilum.
Thirty-three preinfection and 32 postinfection serum samples were obtained from 29 cattle experimentally infected with A. marginale. The cattle were inoculated with different geographical strains of A. marginale, including a Missouri isolate (n = 8), a South Idaho isolate (n = 1), a Virginia isolate (n = 3), and a Florida isolate (n = 17). Infection was confirmed by microscopic visualization of organisms in peripheral blood smears and by detection of antibodies to rMsp5 of A. marginale (cELISA anaplasma antibody test kit; VMRD). These samples were evaluated for antibodies to rMsp5 of A. phagocytophilum, using an indirect ELISA.
Thirty-five human serum samples from the Wadsworth Center, New York State Department of Health, Albany, NY, were evaluated for antibodies to the rMsp5 ortholog of A. phagocytophilum, and for antibodies to rMsp5 of A. marginale, by indirect ELISA and competitive ELISA, using a cELISA anaplasma antibody test kit (VMRD). These samples were obtained from patients who had clinical findings consistent with human granulocytic anaplasmosis and who had been previously diagnosed with A. phagocytophilum infection by demonstration of antibodies reactive with A. phagocytophilum (NY18 strain) by IFA testing and/or PCR analysis. Four serum samples from individuals naturally infected with Ehrlichia chaffeensis were also tested for antibodies to rMsp5 of A. phagocytophilum.
Serum samples from uninfected, clinically healthy dogs, cattle, and humans were used to calculate cutoff values for postinfection sera at 1:100 and 1:300 dilutions for each indirect ELISA. These samples were tested by IFA for antibodies to A. phagocytophilum (canine and human) and for antibodies to A. marginale (bovine) by competitive ELISA, using a cELISA anaplasma antibody test kit (VMRD), and were found to be negative.
SDS-polyacrylamide gel electrophoresis. The protein concentration of rMsp5 was determined by the Coomassie blue G dye-binding assay as previously described (30). The proteins were dissolved in a 3x sample buffer containing 0.1 M Tris (pH 6.8), 5% (wt/vol) SDS, 50% glycerol, and 0.00125% bromophenol blue, either with or without 7.5% ß-mercaptoethanol. Samples were heat denatured at 100°C for 3 min prior to electrophoresis on 10% (wt/vol) SDS-polyacrylamide gels.
Immunoblot analysis. Approximately 3 µg of rMsp5 of A. marginale and A. phagocytophilum, as well as native A. phagocytophilum (NY18 strain) proteins, was loaded into each well and separated by SDS-polyacrylamide gel electrophoresis and electrophoretically transferred to nitrocellulose membranes (Hybond ECL; Amersham International PLC, Little Chalfont, Buckinghamshire, England) as described previously (1). The membranes were blocked for 1 h with 5% skim milk (wt/vol) in 1x phosphate-buffered saline (PBS) with 0.25% Tween 20 and washed with 1% (wt/vol) milk in 1x PBS with 0.25% Tween 20 as described previously (1). Membranes were probed with the anti-A. marginale Msp5 monoclonal antibody ANAF16C1 at a concentration of 0.01 µg/ml. The monoclonal antibody to trypanosome surface antigen, WAT24A1, was used as a negative isotype control at the same concentration. HRP-conjugated anti-Myc antibody was used as a positive control for rMsp5 of A. phagocytophilum at a dilution of 1:15,000. Preinfection sera and sera collected 69 days postinfection from dogs experimentally inoculated with A. phagocytophilum (3) were used as negative and positive controls, respectively. Membranes were then washed with 1% (wt/vol) milk in 1x PBS as described previously (1) and reacted with a secondary antibody, horseradish peroxidase-conjugated anti-mouse immunoglobulin G (whole molecule; Sigma Chemical Co.), at a dilution of 1:15,000. Membranes were processed for enhanced chemiluminescence with detection reagents containing luminol (SuperSignal substrate; Pierce, Rockford, IL) as a substrate and were exposed to X-ray film (Hyperfilm-MP; Amersham International PLC) for visualization of the bound antibody.
Indirect ELISA. Polystyrene microtiter plates (Maxi Sorp; Nunc, Roskilde, Denmark) were coated with 100 µl per well of purified rMsp5 ortholog of A. phagocytophilum (4 µg/ml) in 0.05 M carbonate-bicarbonate buffer, pH 9.6 (Sigma Chemical Co.), or with a purified rMsp5 ortholog of A. marginale (4 µg/ml) that was produced as previously described (2, 38) and incubated overnight at 4°C. The wells were then washed four times with wash buffer containing 1x PBS and 0.5% (vol/vol) Tween 20 and blocked for 60 min at room temperature with 1% (wt/vol) bovine serum albumin (BSA) in 1x PBS. The plates were washed four times as described above and incubated at room temperature with test sera at 1:100 or 1:300 dilution in 1.0% (wt/vol) BSA in 1x PBS (100 µl). The wells were again washed (four times) and incubated at room temperature for 60 min in the presence of alkaline phosphatase-conjugated goat anti-human immunoglobulin G and immunoglobulin M (whole molecule; Jackson ImmunoResearch Laboratories), alkaline phosphatase-conjugated rabbit anti-bovine immunoglobulin G (whole molecule; Sigma Chemical Co.), or alkaline phosphatase-conjugated rabbit anti-dog immunoglobulin G (whole molecule; Sigma Chemical Co.) at a dilution of 1:5,000 in 1% (wt/vol) BSA in 1x PBS. The wells were again washed (four times), and the substrate, p-nitrophenylphosphate (1 mg/ml) in 0.05 M carbonate-bicarbonate buffer, pH 9.6 (Sigma Chemical Co., St. Louis, MO), was added at 100 µl per well and incubated for 90 min at room temperature. Absorbance was measured at 405 nm using a Tecan Rainbow plate reader (Tecan U.S. Inc., Durham, NC).
For each assay, serum samples from seven clinically healthy subjects (human, dog, or cow) were used to establish the cutoff values for determining whether a test sample was positive or negative. These samples were used at dilutions identical to those of the test samples each time an ELISA was performed.
Similarly, in an indirect-ELISA format, rMsp5 of A. marginale and A. phagocytophilum, each at a concentration of 4 µg/ml, were reacted with the A. marginale Msp5 monoclonal antibody ANAF16C1. The monoclonal antibody to trypanosome surface antigen, WAT24A1, was used as a negative control in this assay.
Competitive ELISA.
A cELISA anaplasma antibody test kit (VMRD) was used in cross-reactivity studies of serum samples from A. phagocytophilum-infected humans and dogs. The assay was performed according to the manufacturer's recommendations. Serum samples with
30% inhibition were interpreted as positive for the presence of Anaplasma antibodies. The U.S. Department of Agriculture has approved this assay for the detection of Anaplasma antibodies, particularly in bovine serum samples (17, 37, 38).
Statistical analysis. Data analysis was performed using Microsoft Office Excel 2003 (Microsoft Corporation), SigmaStat for Windows Version 3.11 (Systat Software Inc.), and SigmaPlot 2004 for Windows Version 9.01 (Systat Software, Inc.). For each indirect ELISA, the cutoff value (absorbance reading) used to determine whether a test sample was positive or negative was established using the upper limit of the t distribution-based 99% confidence interval of the mean absorbance value for the negative-control samples. A sample was considered positive if the absorbance value was greater than the 99% confidence interval of the mean absorbance value of the negative controls.
Nucleotide sequence accession numbers. The genes isolated from the various species were given the following GenBank accession numbers: EF185285 to EF185287 (for human isolates 1 to 3), EF185288 (for the horse isolate), EF185289 and EF185290 (for wood rat isolates 1 and 2), EF185291 and EF185292 (for dog isolates 1 and 2), and EF185293 to EF185295 (for sheep isolates 1 to 3).
|
|
|---|
![]() View larger version (72K): [in a new window] |
FIG. 1. Nucleotide alignment of Anaplasma phagocytophilum msp5 from human (United States), equine (Sweden), wood rat (United States), canine (Sweden), and ovine (Norway) samples. Dashes indicate areas of homology, and asterisks indicate areas where sequence data are unavailable.
|
|
View this table: [in a new window] |
TABLE 1. Cross-reactivities between Anaplasma phagocytophilum and A. marginale
|
Thirty-two bovine serum samples were obtained from cattle experimentally infected with A. marginale and were collected on various days after inoculation. Of the 32 bovine samples, 24 tested positive for antibodies against rMsp5 of A. phagocytophilum in indirect ELISAs (Table 1). This result suggests a serologic cross-reactivity of 75%.
In addition, in order to evaluate the specificity of the cELISA anaplasma antibody test kit (VMRD), we tested serum samples from 45 dogs and 35 humans previously shown to be infected with A. phagocytophilum for antibodies to A. marginale Msp5. All 45 canine and 35 human serum samples were negative, indicating that the epitope recognized by the monoclonal antibody used in this assay is not present in A. phagocytophilum.
Western immunoblot analysis was done to evaluate the reactivity of the A. marginale monoclonal antibody ANAF16C1 with native Msp5 and rMsp5 of A. phagocytophilum. Serum from a dog experimentally infected with A. phagocytophilum (69 days postinoculation) and HRP-labeled anti-myc antibody were used as positive controls for the native A. phagocytophilum protein and the rMsp5 ortholog of A. phagocytophilum, respectively. Recombinant A. marginale Msp5 was used as a positive control for monoclonal antibody ANAF16C1. Monoclonal antibody WAT24A1 and preinfection canine sera were used as negative controls. The rMsp5 of A. marginale, a 19-kDa protein, was clearly identified with the monoclonal antibody ANAF16C1 (Fig. 2). The epitope recognized by this monoclonal antibody was not identified in preparations containing native A. phagocytophilum protein or rMsp5 of A. phagocytophilum (Fig. 2).
![]() View larger version (93K): [in a new window] |
FIG. 2. Western immunoblot of monoclonal antibody ANAF16C1, with recombinant Msp5 of A. marginale, recombinant Msp5 of A. phagocytophilum, and native A. phagocytophilum protein used as antigens. Lane 1 contains rMsp5 of A. marginale, with monoclonal antibody ANAF16C1 (0.01 µg/ml) used as a positive control. Lane 2 contains rMsp5 of A. phagocytophilum, with monoclonal antibody WAT24A1 (0.01 µg/ml) used as a negative isotype control. Lane 3 contains rMsp5 of A. phagocytophilum, with anti-Myc antibody (1:15,000 dilution) used as a positive control. Lanes 4 and 5 contain rMsp5 and native A. phagocytophilum protein, respectively, with monoclonal antibody ANAF16C1 (0.01 µg/ml). Lanes 6 and 7 contain native A. phagocytophilum protein, with 69-day-postinfection and preinfection sera (1:300 dilution) from a dog experimentally infected with A. phagocytophilum used as positive and negative controls, respectively. ANAF16C1 identifies Msp5 of A. marginale at a molecular mass of 19 kDa (lane 1), but no reaction is noted with either native or recombinant A. phagocytophilum proteins (lanes 4 and 5). Molecular-size standards (in kDa) are given on the right.
|
To evaluate the cross-reactivity of A. phagocytophilum Msp5 to other closely related rickettsial agents, we performed ELISAs using rMsp5 of A. phagocytophilum and serum samples from 17 dogs experimentally infected with E. canis, 10 dogs naturally infected with A. platys, and four humans naturally infected with E. chaffeensis. All serum samples were evaluated at dilutions of 1:100 and 1:300. All human and canine serum samples were found to be positive for antibodies to rMsp5 of A. phagocytophilum (Table 2).
|
View this table: [in a new window] |
TABLE 2. Cross-reactivities between Anaplasma phagocytophilum and related rickettsial agents
|
|
|
|---|
In this study, we observed serological cross-reactivity between A. phagocytophilum and A. marginale in two situations, using indirect ELISAs: (i) when we used A. phagocytophilum-infected human and canine serum samples and rMsp5 of A. marginale and (ii) when we used A. marginale-infected bovine serum samples with rMsp5 of A. phagocytophilum. Furthermore, with rMsp5 of A. phagocytophilum used in the same indirect-ELISA format, all serum samples from humans infected with E. chaffeensis, dogs infected with E. canis, and dogs infected with A. platys were found to be positive.
Based on these cross-reactivity experiments, infection is likely to be detected in serum samples from animals infected with A. phagocytophilum, A. marginale, E. chaffeensis, E. canis, or A. platys when the whole peptide of rMsp5 of A. phagocytophilum is used as the diagnostic-test antigen in an indirect-ELISA format. We conclude that the use of the whole peptide of rMsp5 of A. phagocytophilum as a test antigen cannot distinguish between infections with Anaplasma spp. or Ehrlichia spp.
The assay currently approved by the U.S. Department of Agriculture (USDA) for screening cattle for A. marginale infection (cELISA anaplasma antibody test kit; VMRD) is a competitive ELISA that utilizes a monoclonal antibody, ANAF16C1. This antibody recognizes an epitope proposed to be specific for A. marginale (37). In our study, sera from humans or canines infected with A. phagocytophilum tested negative when the anaplasma antibody test kit was used. Our results indicate that when used in its proper format (e.g., the cELISA), the rMsp5 of A. marginale can accurately detect infection in cattle and can distinguish between infections with A. phagocytophilum and infections with A. marginale. This is of particular importance when cattle are tested in areas where these two infections coexist.
Recombinant Msp5 of A. marginale has been used as a diagnostic-test antigen in an indirect-ELISA format for surveying A. marginale infection in cattle in several countries (7, 8, 31, 35). Our data indicate that an indirect ELISA using rMsp5 of A. marginale cannot distinguish between infections with A. phagocytophilum and infections with A. marginale. Cattle infected with either organism will likely be seropositive, giving rise to a false representation of disease incidence in a particular area.
The serological cross-reactivity between A. phagocytophilum and A. marginale observed with the commercially available cELISA was previously evaluated (10). In that study, A. phagocytophilum infection was evaluated in various species. Cattle were experimentally infected with a Swiss strain of A. phagocytophilum, sheep with a British (Old Sourhope) strain of A. phagocytophilum, and horses with a human isolate (Webster strain) of A. phagocytophilum from Wisconsin (10). These animals were inconsistently seropositive in the cELISA that used monoclonal antibody ANAF16C1. It was concluded that the epitope recognized by the monoclonal antibody is not species specific for A. marginale. These positive results for the cELISA appeared 4 weeks after inoculation of A. phagocytophilum-infected cattle and eventually converted to negative states by week 10.
In our study, cross-reactivity between sera from humans and dogs infected with A. phagocytophilum and rMsp5 of A. marginale was never observed when we used rMsp5 in its cELISA format. In addition, in a Western immunoblot analysis, monoclonal antibody ANAF16C1 did not react with recombinant or native Msp5 of A. phagocytophilum, but it readily identified rMsp5 of A. marginale. Furthermore, in an indirect ELISA, the monoclonal antibody clearly reacted with rMsp5 of A. marginale; however, no reactivity was observed with the use of rMsp5 of A. phagocytophilum.
There could be several explanations for the discrepancy between our findings and those of the previous study (10). One explanation is that experimental infection, used in the previous study, does not mimic natural infection with A. phagocytophilum in terms of antibody response to A. marginale Msp5. In addition, as indicated in the earlier paper, coinfection with A. marginale and A. phagocytophilum could have been present in the original inoculum that was used to infect the animals, resulting in an altered antibody response. Another explanation for the inhibition of the monoclonal antibody in the cELISA, and a false-positive result, could be steric hindrance of the monoclonal antibody by other antibodies directed against epitopes adjacent to the one recognized by monoclonal antibody ANAF16C1.
In summary, we demonstrated the high conservation of Msp5 of A. phagocytophilum among various isolates in the United States and Europe. This whole antigen has potential as a screening tool for anaplasmosis/ehrlichiosis when used in an indirect-ELISA format. Such a serological assay would provide a time- and cost-effective means for rapid diagnosis and implementation of therapy. Because of the cross-reactivity between the Msp5 orthologs of A. phagocytophilum and A. marginale, the commercially available cELISA should be used in epidemiological studies where distinctions between these two infectious agents in cattle are necessary.
Published ahead of print on 10 January 2007. ![]()
Present address: School of Veterinary Medicine, Louisiana State University. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»