This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Strik, N. I.
Right arrow Articles by Knowles, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Strik, N. I.
Right arrow Articles by Knowles, D. P.

 Previous Article  |  Next Article 

Clinical and Vaccine Immunology, March 2007, p. 262-268, Vol. 14, No. 3
1071-412X/07/$08.00+0     doi:10.1128/CVI.00320-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Characterization of Anaplasma phagocytophilum Major Surface Protein 5 and the Extent of Its Cross-Reactivity with A. marginale{triangledown}

N. I. Strik,1 A. R. Alleman,1* A. F. Barbet,1 H. L. Sorenson,1 H. L. Wamsley,1 F. P. Gaschen,2,{dagger} N. Luckschander,2 S. Wong,3 F. Chu,3 J. E. Foley,4 A. Bjoersdorff,5 S. Stuen,6 and D. P. Knowles7

College of Veterinary Medicine, University of Florida, Gainesville, Florida,1 Vetsuisse Faculty, University of Bern, Bern, Switzerland,2 Wadsworth Center, New York State Department of Health, Albany, New York,3 Department of Medicine and Epidemiology, University of California, Davis, California,4 Department of Clinical Microbiology, Kalmar County Hospital, Kalmar, Sweden,5 Department of Sheep and Goat Research, Norwegian School of Veterinary Science, Sandnes, Norway,6 Animal Disease Research Unit, Agricultural Research Service, USDA, and Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, Washington7

Received 1 September 2006/ Returned for modification 16 October 2006/ Accepted 2 January 2007


arrow
ABSTRACT
 
Major surface protein 5 (Msp5) of Anaplasma marginale is highly conserved in the genus Anaplasma and the antigen used in a commercially available competitive enzyme-linked immunosorbent assay (cELISA) for serologic identification of cattle with anaplasmosis. This study analyzes the degrees of conservation of Msp5 among various isolates of Anaplasma phagocytophilum and the extent of serologic cross-reactivity between recombinant Msp5 (rMsp5) of Anaplasma marginale and A. phagocytophilum. The msp5 genes from various isolates of A. phagocytophilum were sequenced and compared. rMsp5 proteins of A. phagocytophilum and A. marginale were used separately in an indirect ELISA to detect cross-reactivity in serum samples from humans and dogs infected with A. phagocytophilum and cattle infected with A. marginale. Serum samples were also tested with a commercially available competitive ELISA that uses monoclonal antibody ANAF16C1. There were 100% sequence identities in the msp5 genes among all of the A. phagocytophilum isolates from the United States and a horse isolate from Sweden. Sheep isolates from Norway and dog isolates from Sweden were 99% identical to one another but differed in 17 base pairs from the United States isolates and the horse isolate. Serologic cross-reactivity was identified when serum samples from cattle infected with A. marginale were reacted with rMsp5 of A. phagocytophilum and when serum samples from humans and dogs infected with A. phagocytophilum were reacted with rMsp5 of A. marginale in an indirect-ELISA format. Serum samples from dogs or humans infected with A. phagocytophilum did not cross-react with rMsp5 of A. marginale when tested with the commercially available cELISA. These results suggest that rMsp5 of A. phagocytophilum is highly conserved among United States and European isolates and that serologic distinction between A. phagocytophilum and A. marginale infections cannot be accomplished if rMsp5 from either organism is used in an indirect ELISA.


arrow
INTRODUCTION
 
The order Rickettsiales represents obligate intracellular bacteria that reside in vacuoles of eukaryotic cells, with the potential to cause fatal tick-transmitted diseases in humans and several mammalian species. Recent genetic studies reorganized some species within the order Rickettsiales, between the families Rickettsiaceae and Anaplasmataceae (11). Based on these studies, three organisms, formerly known as Ehrlichia phagocytophila, Ehrlichia equi, and the HGE (human granulocytic ehrlichiosis) agent, were unified as a single species and moved to the genus Anaplasma. These three organisms are now reclassified as Anaplasma phagocytophilum, the causative agent of granulocytic anaplasmosis, an emerging tick-borne disease (6, 11).

A. phagocytophilum has been detected worldwide, particularly in North America and Europe as well as in South Africa, South America, and Asia; it infects humans, horses, ruminants, cats, dogs, and a variety of wildlife species, including rodents, deer, and carnivores (4, 9, 12, 14, 15, 16, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 33, 34, 36, 39, 40, 41, 42). Clinical signs of infection, although differing with the species of host and the virulence, include fever, anorexia, anemia, thrombocytopenia, leukopenia, neurological signs, hepatic inflammation, abortions, and even fatalities in a small percentage of mammalian hosts. Current serologic diagnosis is most often based on an indirect immunofluorescent antibody (IFA) test that uses whole, cultured organisms as a test antigen.

The serologic diagnosis of Anaplasma marginale infection is based on a commercially available competitive inhibition enzyme-linked immunosorbent assay (cELISA) developed in the mid-1990s (17, 38). This highly sensitive and specific assay uses recombinant Msp5 (rMsp5) as a diagnostic antigen, along with horseradish peroxidase (HRP)-conjugated monoclonal antibody ANAF16C1, which binds to an epitope specific for Msp5 of A. marginale (37).

Even before the recent reclassification within the family Anaplasmataceae, the msp5 gene was known to be highly conserved among all Anaplasma species, which, at that time, included A. marginale, A. centrale, and A. ovis (17). Based on 16S rRNA gene sequence similarity, A. phagocytophilum and A. platys were placed within the same family (11).

In this study, we investigate the conservation of the msp5 gene among various geographic isolates of A. phagocytophilum through cloning and sequencing of msp5, and we examine the level of cross-reactivity and the potential value of rMsp5 orthologs of A. phagocytophilum and A. marginale as test antigens for serodiagnosis of anaplasmosis.


arrow
MATERIALS AND METHODS
 
Source of A. phagocytophilum DNA. A. phagocytophilum genomic DNA samples were extracted from three individuals naturally infected with A. phagocytophilum (New York State) and from a human isolate that was in culture (NY18E2b), three ovine samples (Norway), two canine samples (Sweden), two wood rat samples (California), and one equine sample (Sweden).

Amplification of the msp5 gene of A. phagocytophilum. Primers which corresponded to the sequences encoding the predicted translated and processed proteins of the msp5 gene were synthesized by Genosys Biotechnologies Inc., The Woodlands, TX. Forward primer ARA28 (5' ACTGTGTTTCTGGGGTATTCGTATGTTAAC 3') and reverse primer ARA29 (5' AGAATTAAGGTACTTATTAACGAAATCAAA 3') were designed for in-frame insertion of amplicons into the pTrcHis2-TOPO vector (Invitrogen Corporation, Carlsbad, CA). The N terminus of the mature protein, without the peptide signal sequence, corresponds to nucleotide 46 of the open reading frame. Amplification was performed using Pfu DNA polymerase (Stratagene, La Jolla, CA). Briefly, 10 ng/µl of genomic DNA was amplified using 0.5 µM each of primers ARA28 and ARA29 and 1.00 U of Pfu polymerase in 5 mM deoxynucleoside triphosphates, 10 mM Tris-HCl (pH 8.8), 50 mM KCl, and 1.5 mM MgCl2. PCR assays were performed at 94°C for 3 min, followed by 10 cycles of denaturing at 94°C for 15 s, annealing at 43°C for 1 min, and extension at 72°C for 2 min. This was followed by 25 cycles of denaturing at 94°C for 15 s, annealing at 49°C for 1 min, and extension at 72°C for 2 min. A final extension step at 72°C was performed for 7 min. Amplicons were analyzed by gel electrophoresis on a 1% agarose gel in 1x TBE buffer (89 mM Tris, 89 mM boric acid, and 2 mM disodium EDTA).

Cloning and sequencing of A. phagocytophilum msp5. Amplicons were incubated at 72°C for 10 min in 1.0 U of Taq DNA polymerase in order to produce amplicons with the 3' A overhangs needed for ligation into the TOPO vector inserted into the pTrcHis2-TOPO vector (Invitrogen Corporation). Cloning was performed according to the manufacturer's recommendations. Recombinant plasmids were transformed into Escherichia coli (One Shot cells; Invitrogen Corporation), and transformants were grown on Luria-Bertani (LB) agar plates in the presence of ampicillin (50 µg/ml). Colonies were selected and incubated in LB broth in the presence of ampicillin (50 µg/ml) overnight at 37°C with vigorous shaking. Plasmid DNA was extracted by a rapid miniprep method (43), reconstituted in Tris-EDTA buffer (pH 8.0) containing 1.0 µg/ml of DNase-free RNase, and analyzed on a 1% agarose gel. Recombinant clones containing the msp5 orthologs of A. phagocytophilum were digested with restriction enzyme EcoRI to ensure the correct orientation of the insert in the plasmid vector. Digested DNA was analyzed on a 1% agarose gel. The DNA sequences of both strands of the 582-bp insert of pTrcHis2-TOPO K1 were determined by the DNA Sequencing Core Laboratory at the University of Florida, Gainesville, FL. The DNA sequences of the msp5 genes from various geographic isolates from A. phagocytophilum were determined for both strands, using forward and reverse primers based on vector sequences in flanking regions. DNA sequences were compared by Seqweb (Genetics Computer Group, Madison, WI).

A. phagocytophilum recombinant Msp5 production and purification. Transformed cells containing the msp5 gene ortholog of A. phagocytophilum were incubated with vigorous shaking at 37°C in Luria-Bertani broth containing 50 µg/ml ampicillin overnight. A tenfold dilution of this overnight culture was added to Terrific Broth medium (32) containing 500 mM glycylglycine (13) and incubated with vigorous shaking to an optical density at 600 nm of 1.0. Protein production was induced with 0.5 mM isopropyl-ß-D-thiogalactopyranoside. Cells were incubated with vigorous shaking at 27°C for an additional 16 h. Recombinant proteins were purified by immobilized metal affinity chromatography (ProBond resin; Invitrogen Corporation) and isolated under native, nondenaturing conditions, using solutions with pH levels of 7.8, 6.0, and 5.5 and eluting at pH 4.0, according to the manufacturer's recommendations. Fractions containing the rMsp5 ortholog were identified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and staining with Coomassie blue. The rMsp5 protein contained a C-terminal polyhistidine tag for purification by affinity chromatography and a C-terminal Myc tag for protein identification in immunoblot assays. The authenticity of the rMsp5 ortholog of A. phagocytophilum was evaluated by Western immunoblot analysis using an HRP-conjugated anti-Myc antibody (Invitrogen Corporation) and pre- and postinoculation sera from a dog experimentally infected with A. phagocytophilum.

Antibodies and antisera. Monoclonal antibody ANAF16C1 (cELISA anaplasma antibody test kit; VMRD, Pullman, WA) was used as a positive control for the A. marginale rMsp5 ortholog in immunoblot assays. WAT24A1, a monoclonal antibody against trypanosome surface antigen, was used as a negative control in immunoblot assays and in an indirect ELISA with rMsp5 of A. phagocytophilum and rMsp5 of A. marginale. Horseradish peroxidase-labeled anti-Myc antibody (anti-Myc [C-terminal]-HRP; Invitrogen Corporation) was used as a positive control for the A. phagocytophilum rMsp5 ortholog in immunoblot assays.

Alkaline phosphatase-conjugated rabbit anti-dog immunoglobulin G (whole molecule; Sigma Chemical Co., St. Louis, MO), alkaline phosphatase-conjugated goat anti-human immunoglobulin G and immunoglobulin M (whole molecule; Jackson ImmunoResearch Laboratories, West Grove, PA), alkaline phosphatase-conjugated rabbit anti-bovine immunoglobulin G (whole molecule; Sigma Chemical Co.), and alkaline phosphatase-conjugated rabbit anti-mouse immunoglobulin G (whole molecule; Sigma Chemical Co.) were used as secondary antibodies in indirect ELISAs.

Twenty pre- and postinfection serum samples were collected from 0 to 94 days from each of two dogs experimentally infected with the NY18 strain of A. phagocytophilum (3). In addition, five serum samples from dogs naturally infected with A. phagocytophilum (one from the University of Florida and four from the Vetsuisse Faculty of Berne, Switzerland) were evaluated for antibodies to rMsp5 of A. phagocytophilum and A. marginale. Nine postinfection serum samples from three dogs experimentally infected with a Swedish isolate of A. phagocytophilum were tested for antibodies to rMsp5 of A. phagocytophilum, using an indirect ELISA.

Seventeen serum samples from dogs naturally infected with Ehrlichia canis and 10 serum samples from dogs naturally infected with Anaplasma platys were tested for antibodies to rMsp5 of A. phagocytophilum.

Thirty-three preinfection and 32 postinfection serum samples were obtained from 29 cattle experimentally infected with A. marginale. The cattle were inoculated with different geographical strains of A. marginale, including a Missouri isolate (n = 8), a South Idaho isolate (n = 1), a Virginia isolate (n = 3), and a Florida isolate (n = 17). Infection was confirmed by microscopic visualization of organisms in peripheral blood smears and by detection of antibodies to rMsp5 of A. marginale (cELISA anaplasma antibody test kit; VMRD). These samples were evaluated for antibodies to rMsp5 of A. phagocytophilum, using an indirect ELISA.

Thirty-five human serum samples from the Wadsworth Center, New York State Department of Health, Albany, NY, were evaluated for antibodies to the rMsp5 ortholog of A. phagocytophilum, and for antibodies to rMsp5 of A. marginale, by indirect ELISA and competitive ELISA, using a cELISA anaplasma antibody test kit (VMRD). These samples were obtained from patients who had clinical findings consistent with human granulocytic anaplasmosis and who had been previously diagnosed with A. phagocytophilum infection by demonstration of antibodies reactive with A. phagocytophilum (NY18 strain) by IFA testing and/or PCR analysis. Four serum samples from individuals naturally infected with Ehrlichia chaffeensis were also tested for antibodies to rMsp5 of A. phagocytophilum.

Serum samples from uninfected, clinically healthy dogs, cattle, and humans were used to calculate cutoff values for postinfection sera at 1:100 and 1:300 dilutions for each indirect ELISA. These samples were tested by IFA for antibodies to A. phagocytophilum (canine and human) and for antibodies to A. marginale (bovine) by competitive ELISA, using a cELISA anaplasma antibody test kit (VMRD), and were found to be negative.

SDS-polyacrylamide gel electrophoresis. The protein concentration of rMsp5 was determined by the Coomassie blue G dye-binding assay as previously described (30). The proteins were dissolved in a 3x sample buffer containing 0.1 M Tris (pH 6.8), 5% (wt/vol) SDS, 50% glycerol, and 0.00125% bromophenol blue, either with or without 7.5% ß-mercaptoethanol. Samples were heat denatured at 100°C for 3 min prior to electrophoresis on 10% (wt/vol) SDS-polyacrylamide gels.

Immunoblot analysis. Approximately 3 µg of rMsp5 of A. marginale and A. phagocytophilum, as well as native A. phagocytophilum (NY18 strain) proteins, was loaded into each well and separated by SDS-polyacrylamide gel electrophoresis and electrophoretically transferred to nitrocellulose membranes (Hybond ECL; Amersham International PLC, Little Chalfont, Buckinghamshire, England) as described previously (1). The membranes were blocked for 1 h with 5% skim milk (wt/vol) in 1x phosphate-buffered saline (PBS) with 0.25% Tween 20 and washed with 1% (wt/vol) milk in 1x PBS with 0.25% Tween 20 as described previously (1). Membranes were probed with the anti-A. marginale Msp5 monoclonal antibody ANAF16C1 at a concentration of 0.01 µg/ml. The monoclonal antibody to trypanosome surface antigen, WAT24A1, was used as a negative isotype control at the same concentration. HRP-conjugated anti-Myc antibody was used as a positive control for rMsp5 of A. phagocytophilum at a dilution of 1:15,000. Preinfection sera and sera collected 69 days postinfection from dogs experimentally inoculated with A. phagocytophilum (3) were used as negative and positive controls, respectively. Membranes were then washed with 1% (wt/vol) milk in 1x PBS as described previously (1) and reacted with a secondary antibody, horseradish peroxidase-conjugated anti-mouse immunoglobulin G (whole molecule; Sigma Chemical Co.), at a dilution of 1:15,000. Membranes were processed for enhanced chemiluminescence with detection reagents containing luminol (SuperSignal substrate; Pierce, Rockford, IL) as a substrate and were exposed to X-ray film (Hyperfilm-MP; Amersham International PLC) for visualization of the bound antibody.

Indirect ELISA. Polystyrene microtiter plates (Maxi Sorp; Nunc, Roskilde, Denmark) were coated with 100 µl per well of purified rMsp5 ortholog of A. phagocytophilum (4 µg/ml) in 0.05 M carbonate-bicarbonate buffer, pH 9.6 (Sigma Chemical Co.), or with a purified rMsp5 ortholog of A. marginale (4 µg/ml) that was produced as previously described (2, 38) and incubated overnight at 4°C. The wells were then washed four times with wash buffer containing 1x PBS and 0.5% (vol/vol) Tween 20 and blocked for 60 min at room temperature with 1% (wt/vol) bovine serum albumin (BSA) in 1x PBS. The plates were washed four times as described above and incubated at room temperature with test sera at 1:100 or 1:300 dilution in 1.0% (wt/vol) BSA in 1x PBS (100 µl). The wells were again washed (four times) and incubated at room temperature for 60 min in the presence of alkaline phosphatase-conjugated goat anti-human immunoglobulin G and immunoglobulin M (whole molecule; Jackson ImmunoResearch Laboratories), alkaline phosphatase-conjugated rabbit anti-bovine immunoglobulin G (whole molecule; Sigma Chemical Co.), or alkaline phosphatase-conjugated rabbit anti-dog immunoglobulin G (whole molecule; Sigma Chemical Co.) at a dilution of 1:5,000 in 1% (wt/vol) BSA in 1x PBS. The wells were again washed (four times), and the substrate, p-nitrophenylphosphate (1 mg/ml) in 0.05 M carbonate-bicarbonate buffer, pH 9.6 (Sigma Chemical Co., St. Louis, MO), was added at 100 µl per well and incubated for 90 min at room temperature. Absorbance was measured at 405 nm using a Tecan Rainbow plate reader (Tecan U.S. Inc., Durham, NC).

For each assay, serum samples from seven clinically healthy subjects (human, dog, or cow) were used to establish the cutoff values for determining whether a test sample was positive or negative. These samples were used at dilutions identical to those of the test samples each time an ELISA was performed.

Similarly, in an indirect-ELISA format, rMsp5 of A. marginale and A. phagocytophilum, each at a concentration of 4 µg/ml, were reacted with the A. marginale Msp5 monoclonal antibody ANAF16C1. The monoclonal antibody to trypanosome surface antigen, WAT24A1, was used as a negative control in this assay.

Competitive ELISA. A cELISA anaplasma antibody test kit (VMRD) was used in cross-reactivity studies of serum samples from A. phagocytophilum-infected humans and dogs. The assay was performed according to the manufacturer's recommendations. Serum samples with ≥30% inhibition were interpreted as positive for the presence of Anaplasma antibodies. The U.S. Department of Agriculture has approved this assay for the detection of Anaplasma antibodies, particularly in bovine serum samples (17, 37, 38).

Statistical analysis. Data analysis was performed using Microsoft Office Excel 2003 (Microsoft Corporation), SigmaStat for Windows Version 3.11 (Systat Software Inc.), and SigmaPlot 2004 for Windows Version 9.01 (Systat Software, Inc.). For each indirect ELISA, the cutoff value (absorbance reading) used to determine whether a test sample was positive or negative was established using the upper limit of the t distribution-based 99% confidence interval of the mean absorbance value for the negative-control samples. A sample was considered positive if the absorbance value was greater than the 99% confidence interval of the mean absorbance value of the negative controls.

Nucleotide sequence accession numbers. The genes isolated from the various species were given the following GenBank accession numbers: EF185285 to EF185287 (for human isolates 1 to 3), EF185288 (for the horse isolate), EF185289 and EF185290 (for wood rat isolates 1 and 2), EF185291 and EF185292 (for dog isolates 1 and 2), and EF185293 to EF185295 (for sheep isolates 1 to 3).


arrow
RESULTS
 
The open reading frame of the msp5 gene of A. phagocytophilum is 582 bp in length. The nucleotide sequences of various geographic isolates, including samples from three humans from New York State, two wood rats from California, three sheep from Norway, and one horse and two dogs from Sweden, were compared to that of the cultured msp5 NY18E2b strain of A. phagocytophilum (Fig. 1) . All isolates from the United States and the horse isolate from Sweden displayed 100% nucleotide sequence identities in their msp5 genes. The sheep isolates from Norway and the canine isolates from Sweden were 99% identical to one another (differing in 8 bp), but they differed from the U.S. isolates and the equine isolate from Sweden in a total of 20 bp. When the amino acid sequences of Msp5 of A. phagocytophilum and Msp5 of A. marginale were compared, 65.1% sequence identity and 70.8% sequence similarity were found (3).


Figure 1
View larger version (72K):
[in this window]
[in a new window]

 
FIG. 1. Nucleotide alignment of Anaplasma phagocytophilum msp5 from human (United States), equine (Sweden), wood rat (United States), canine (Sweden), and ovine (Norway) samples. Dashes indicate areas of homology, and asterisks indicate areas where sequence data are unavailable.

Indirect enzyme-linked immunosorbent assays using rMsp5 of A. marginale were performed on 45 A. phagocytophilum-positive canine serum samples at dilutions of 1:100 and 1:300. All but one serum sample tested positive for antibodies to rMsp5 of A. marginale (Table 1). These results suggest a serologic cross-reactivity of 98%.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Cross-reactivities between Anaplasma phagocytophilum and A. marginale

Thirty-five human serum samples from patients naturally infected with A. phagocytophilum and showing clinical signs of human anaplasmosis were tested for antibodies to rMsp5 of A. marginale in indirect ELISAs. Twenty-nine of the 35 human serum samples tested positive at dilutions of both 1:100 and 1:300 when evaluated by the indirect ELISA using rMsp5 of A. marginale. An additional five human serum samples tested positive at a dilution of 1:100 but were negative at the higher dilution (Table 1). Those results suggest a serologic cross-reactivity of 97%.

Thirty-two bovine serum samples were obtained from cattle experimentally infected with A. marginale and were collected on various days after inoculation. Of the 32 bovine samples, 24 tested positive for antibodies against rMsp5 of A. phagocytophilum in indirect ELISAs (Table 1). This result suggests a serologic cross-reactivity of 75%.

In addition, in order to evaluate the specificity of the cELISA anaplasma antibody test kit (VMRD), we tested serum samples from 45 dogs and 35 humans previously shown to be infected with A. phagocytophilum for antibodies to A. marginale Msp5. All 45 canine and 35 human serum samples were negative, indicating that the epitope recognized by the monoclonal antibody used in this assay is not present in A. phagocytophilum.

Western immunoblot analysis was done to evaluate the reactivity of the A. marginale monoclonal antibody ANAF16C1 with native Msp5 and rMsp5 of A. phagocytophilum. Serum from a dog experimentally infected with A. phagocytophilum (69 days postinoculation) and HRP-labeled anti-myc antibody were used as positive controls for the native A. phagocytophilum protein and the rMsp5 ortholog of A. phagocytophilum, respectively. Recombinant A. marginale Msp5 was used as a positive control for monoclonal antibody ANAF16C1. Monoclonal antibody WAT24A1 and preinfection canine sera were used as negative controls. The rMsp5 of A. marginale, a 19-kDa protein, was clearly identified with the monoclonal antibody ANAF16C1 (Fig. 2). The epitope recognized by this monoclonal antibody was not identified in preparations containing native A. phagocytophilum protein or rMsp5 of A. phagocytophilum (Fig. 2).


Figure 2
View larger version (93K):
[in this window]
[in a new window]

 
FIG. 2. Western immunoblot of monoclonal antibody ANAF16C1, with recombinant Msp5 of A. marginale, recombinant Msp5 of A. phagocytophilum, and native A. phagocytophilum protein used as antigens. Lane 1 contains rMsp5 of A. marginale, with monoclonal antibody ANAF16C1 (0.01 µg/ml) used as a positive control. Lane 2 contains rMsp5 of A. phagocytophilum, with monoclonal antibody WAT24A1 (0.01 µg/ml) used as a negative isotype control. Lane 3 contains rMsp5 of A. phagocytophilum, with anti-Myc antibody (1:15,000 dilution) used as a positive control. Lanes 4 and 5 contain rMsp5 and native A. phagocytophilum protein, respectively, with monoclonal antibody ANAF16C1 (0.01 µg/ml). Lanes 6 and 7 contain native A. phagocytophilum protein, with 69-day-postinfection and preinfection sera (1:300 dilution) from a dog experimentally infected with A. phagocytophilum used as positive and negative controls, respectively. ANAF16C1 identifies Msp5 of A. marginale at a molecular mass of 19 kDa (lane 1), but no reaction is noted with either native or recombinant A. phagocytophilum proteins (lanes 4 and 5). Molecular-size standards (in kDa) are given on the right.

In a different format, the reactivity of the monoclonal antibody ANAF16C1 was used in an indirect ELISA with rMsp5 of A. phagocytophilum and rMsp5 of A. marginale. The monoclonal antibody reacted only with rMsp5 of A. marginale; it did not react with rMsp5 of A. phagocytophilum (data not shown).

To evaluate the cross-reactivity of A. phagocytophilum Msp5 to other closely related rickettsial agents, we performed ELISAs using rMsp5 of A. phagocytophilum and serum samples from 17 dogs experimentally infected with E. canis, 10 dogs naturally infected with A. platys, and four humans naturally infected with E. chaffeensis. All serum samples were evaluated at dilutions of 1:100 and 1:300. All human and canine serum samples were found to be positive for antibodies to rMsp5 of A. phagocytophilum (Table 2).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Cross-reactivities between Anaplasma phagocytophilum and related rickettsial agents


arrow
DISCUSSION
 
The nucleotide sequence similarities among the various msp5 genes of A. phagocytophilum indicate the high conservation of the gene product, Msp5, across isolates from the United States and Europe. The msp5 gene of Anaplasma spp. and its ortholog, map2 of Ehrlichia spp., are both known to be highly conserved within the genera Anaplasma and Ehrlichia (2, 5, 18, 20, 38). Additionally, based on the amino acid identity of 40.2% among all known orthologs of Msp5/Map2 of Anaplasma and Ehrlichia (3), cross-reactivity among organisms within the genera appears likely when Msp5 of Anaplasma phagocytophilum is used as a test antigen in serologic assays.

In this study, we observed serological cross-reactivity between A. phagocytophilum and A. marginale in two situations, using indirect ELISAs: (i) when we used A. phagocytophilum-infected human and canine serum samples and rMsp5 of A. marginale and (ii) when we used A. marginale-infected bovine serum samples with rMsp5 of A. phagocytophilum. Furthermore, with rMsp5 of A. phagocytophilum used in the same indirect-ELISA format, all serum samples from humans infected with E. chaffeensis, dogs infected with E. canis, and dogs infected with A. platys were found to be positive.

Based on these cross-reactivity experiments, infection is likely to be detected in serum samples from animals infected with A. phagocytophilum, A. marginale, E. chaffeensis, E. canis, or A. platys when the whole peptide of rMsp5 of A. phagocytophilum is used as the diagnostic-test antigen in an indirect-ELISA format. We conclude that the use of the whole peptide of rMsp5 of A. phagocytophilum as a test antigen cannot distinguish between infections with Anaplasma spp. or Ehrlichia spp.

The assay currently approved by the U.S. Department of Agriculture (USDA) for screening cattle for A. marginale infection (cELISA anaplasma antibody test kit; VMRD) is a competitive ELISA that utilizes a monoclonal antibody, ANAF16C1. This antibody recognizes an epitope proposed to be specific for A. marginale (37). In our study, sera from humans or canines infected with A. phagocytophilum tested negative when the anaplasma antibody test kit was used. Our results indicate that when used in its proper format (e.g., the cELISA), the rMsp5 of A. marginale can accurately detect infection in cattle and can distinguish between infections with A. phagocytophilum and infections with A. marginale. This is of particular importance when cattle are tested in areas where these two infections coexist.

Recombinant Msp5 of A. marginale has been used as a diagnostic-test antigen in an indirect-ELISA format for surveying A. marginale infection in cattle in several countries (7, 8, 31, 35). Our data indicate that an indirect ELISA using rMsp5 of A. marginale cannot distinguish between infections with A. phagocytophilum and infections with A. marginale. Cattle infected with either organism will likely be seropositive, giving rise to a false representation of disease incidence in a particular area.

The serological cross-reactivity between A. phagocytophilum and A. marginale observed with the commercially available cELISA was previously evaluated (10). In that study, A. phagocytophilum infection was evaluated in various species. Cattle were experimentally infected with a Swiss strain of A. phagocytophilum, sheep with a British (Old Sourhope) strain of A. phagocytophilum, and horses with a human isolate (Webster strain) of A. phagocytophilum from Wisconsin (10). These animals were inconsistently seropositive in the cELISA that used monoclonal antibody ANAF16C1. It was concluded that the epitope recognized by the monoclonal antibody is not species specific for A. marginale. These positive results for the cELISA appeared 4 weeks after inoculation of A. phagocytophilum-infected cattle and eventually converted to negative states by week 10.

In our study, cross-reactivity between sera from humans and dogs infected with A. phagocytophilum and rMsp5 of A. marginale was never observed when we used rMsp5 in its cELISA format. In addition, in a Western immunoblot analysis, monoclonal antibody ANAF16C1 did not react with recombinant or native Msp5 of A. phagocytophilum, but it readily identified rMsp5 of A. marginale. Furthermore, in an indirect ELISA, the monoclonal antibody clearly reacted with rMsp5 of A. marginale; however, no reactivity was observed with the use of rMsp5 of A. phagocytophilum.

There could be several explanations for the discrepancy between our findings and those of the previous study (10). One explanation is that experimental infection, used in the previous study, does not mimic natural infection with A. phagocytophilum in terms of antibody response to A. marginale Msp5. In addition, as indicated in the earlier paper, coinfection with A. marginale and A. phagocytophilum could have been present in the original inoculum that was used to infect the animals, resulting in an altered antibody response. Another explanation for the inhibition of the monoclonal antibody in the cELISA, and a false-positive result, could be steric hindrance of the monoclonal antibody by other antibodies directed against epitopes adjacent to the one recognized by monoclonal antibody ANAF16C1.

In summary, we demonstrated the high conservation of Msp5 of A. phagocytophilum among various isolates in the United States and Europe. This whole antigen has potential as a screening tool for anaplasmosis/ehrlichiosis when used in an indirect-ELISA format. Such a serological assay would provide a time- and cost-effective means for rapid diagnosis and implementation of therapy. Because of the cross-reactivity between the Msp5 orthologs of A. phagocytophilum and A. marginale, the commercially available cELISA should be used in epidemiological studies where distinctions between these two infectious agents in cattle are necessary.


arrow
ACKNOWLEDGMENTS
 
This investigation was supported by the University of Florida, Division of Sponsored Research, project number 7255102-12.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: College of Veterinary Medicine, University of Florida, 2015 S.W. 16th Ave., Box 100103, Gainesville, FL 32610. Phone: (352) 392-4700. Fax: (353) 392-2938. E-mail: AllemanR{at}mail.vetmed.ufl.edu. Back

{triangledown} Published ahead of print on 10 January 2007. Back

{dagger} Present address: School of Veterinary Medicine, Louisiana State University. Back


arrow
REFERENCES
 
    1
  1. Alleman, A. R., and A. F. Barbet. 1996. Evaluation of Anaplasma marginale major surface protein 3 (MSP3) as a diagnostic test antigen. J. Clin. Microbiol. 34:270-276.[Abstract]
  2. 2
  3. Alleman, A. R., L. J. McSherry, A. F. Barbet, E. B. Breitschwerdt, H. L. Sorenson, M. J. Bowie, and M. Belanger. 2001. Recombinant major antigenic protein 2 of Ehrlichia canis: a potential diagnostic tool. J. Clin. Microbiol. 39:2494-2499.[Abstract/Free Full Text]
  4. 3
  5. Alleman, A. R., A. F. Barbet, H. L. Sorenson, N. I. Strik, H. L. Wamsley, S. Song, E. Munderloh, C. Ramswamey, F. P. Gaschen, N. Luckschander, and A. Bjoersdorff. 2006. Cloning and expression of the gene encoding the major surface protein 5 (MSP5) of Anaplasma phagocytophilum and potential application for serodiagnosis. Vet. Clin. Pathol. 35:418-425.[Medline]
  6. 4
  7. Bjoersdorff, A., B. Wittesjo, J. Berglun, R. F. Massung, and I. Eliasson. 2002. Human granulocytic ehrlichiosis as a common tick-associated fever in Southeast Sweden: report from a retrospective clinical study. Scand. J. Infect. Dis. 34:187-191.[CrossRef][Medline]
  8. 5
  9. Bowie, M. V., G. R. Reddy, S. M. Semu, S. M. Mahan, and A. F. Barbet. 1999. Potential value of major antigenic protein 2 for serological diagnosis of heartwater and related ehrlichial infections. Clin. Diagn. Lab. Immunol. 6:209-215.
  10. 6
  11. Chen, S. M., J. S. Dumler, J. S. Bakken, and D. H. Walker. 1994. Identification of a granulocytotrophic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32:589-595.[Abstract/Free Full Text]
  12. 7
  13. Cringoli, G., D. Otranto, G. Testini, V. Buono, G. Di Giulio, D. Traversa, R. Lia, L. Rinaldi, V. Veneziano, and V. Puccini. 2002. Epidemiology of bovine tick-borne diseases in southern Italy. Vet. Res. 33:421-426.[CrossRef][Medline]
  14. 8
  15. De Echaide, S. T., M. F. Bono, C. Lugaresi, N. Aguirre, A. Mangold, R. Moretta, M. Farber, and C. Mondillo. 2005. Detection of antibodies against Anaplasma marginale in milk using a recombinant MSP5 indirect ELISA. Vet. Microbiol. 106:287-292.[CrossRef][Medline]
  16. 9
  17. De la Fuente, J., A. Torina, S. Caracappa, G. Tumino, R. Furla, C. Almazan, and K. M. Kocan. 2005. Serologic and molecular characterization of Anaplasma species infection in farm animal and ticks from Sicily. Vet. Parasitol. 133:357-362.[CrossRef][Medline]
  18. 10
  19. Dreher, U. M., J. de la Fuente, R. Hofmann-Lehmann, M. L. Meli, N. Pusterla, K. M. Kocan, Z. Woldehiwet, U. Braun, G. Regula, K. D. C. Staerk, and H. Lutz. 2005. Serologic cross-reactivity between Anaplasma marginale and Anaplasma phagocytophilum. Clin. Diagn. Lab. Immunol. 12:1177-1183.
  20. 11
  21. Dumler, J. S., A. F. Barbet, C. P. Bekker, G. A. Dasch, G. H. Palmer, S. C. Ray, Y. Rikihisa, and F. R. Rurangirwa. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and HGE agent as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145-2165.[Abstract]
  22. 12
  23. Foley, J. E., P. Foley, M. Jecker, P. K. Swift, and J. E. Madigan. 1999. Granulocytic ehrlichiosis and tick infestation in mountain lions from California. J. Wildl. Dis. 35:703-709.[Abstract]
  24. 13
  25. Ghosh, S., S. Rasheedi, S. S. Rahim, S. Banerjee, R. K. Choudhary, P. Chakhaiyar, N. Z. Ehtesham, S. Mukhopadhyay, and S. E. Hasnain. 2004. Method for enhancing solubility of the expressed recombinant proteins in Escherichia coli. BioTechniques 37:418-423.[Medline]
  26. 14
  27. Greig, B., K. M. Asanovich, P. J. Armstrong, and J. S. Dumler. 1996. Geographic, clinical, serologic, and molecular evidence of granulocytic ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin dogs. J. Clin. Microbiol. 34:44-48.[Abstract]
  28. 15
  29. Heo, E. J., J. H. Park, J. R. Koo, M. S. Park, M. Y. Park, J. S. Dumler, and J. S. Chae. 2002. Serologic and molecular detection of Ehrlichia chaffeensis and Anaplasma phagocytophila (human granulocytic ehrlichiosis agent) in Korean patients. J. Clin. Microbiol. 40:3082-3085.[Abstract/Free Full Text]
  30. 16
  31. Inokuma, H., M. Oyamada, P. J. Kelly, L. A. Jacobson, P.-E. Fournier, K. Itamoto, M. Okuda, and P. Brouqui. 2005. Molecular detection of a new Anaplasma species closely related to Anaplasma phagocytophilum in canine blood from South Africa. J. Clin. Microbiol. 43:2934-2937.[Abstract/Free Full Text]
  32. 17
  33. Knowles, D., S. Torioni deEchaide, G. Palmer, T. McGuire, D. Stiller, and T. McElwain. 1996. Antibody against Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle. J. Clin. Microbiol. 34:2225-2230.[Abstract]
  34. 18
  35. Knowles, T. T., A. R. Alleman, H. L. Sorenson, D. C. Marciano, E. B. Breitschwerdt, S. Harrus, A. F. Barbet, and M. Belanger. 2003. Characterization of the major antigenic protein 2 of Ehrlichia canis and E. chaffeensis and its application for the serodiagnosis of ehrlichiosis. Clin. Diagn. Lab. Immunol. 10:520-524.
  36. 19
  37. Lappin, M. R., E. B. Breitschwerdt, W. A. Jensen, B. Dunnigan, J. Y. Rha, C. R. Williams, M. Brewer, and M. Fall. 2004. Molecular and serologic evidence of Anaplasma phagocytophilum infection in cats in North America. J. Am. Vet. Med. Assoc. 225:893-896, 879.[CrossRef][Medline]
  38. 20
  39. Mahan, S. M., T. C. McGuire, S. M. Semu, M. V. Bowie, F. Jongejan, F. R. Rurangirwa, and A. F. Barbet. 1994. Molecular cloning of a gene encoding the immunogenic 21 kDa protein of Cowdria ruminantium. Microbiology 140:2135-2142.[Abstract/Free Full Text]
  40. 21
  41. Manna, L., A. Alberti, L. M. Pavone, A. Scibelli, N. Staiano, and A. E. Gravino. 2004. First molecular characterization of a granulocytic Ehrlichia strain isolated from a dog in South Italy. Vet. J. 167:224-227.[CrossRef][Medline]
  42. 22
  43. Ogden, N. H., K. Bown, B. K. Horrocks, Z. Woldehiwet, and M. Bennett. 1998. Granulocytic Ehrlichia infection in Ixodid ticks and mammals in woodlands and uplands of the U.K. Med. Vet. Entomol. 12:423-429.[CrossRef][Medline]
  44. 23
  45. Parola, P., R. S. Miller, P. McDaniel, S. R. Telford III, J. M. Rolain, C. Wongsrichanalai, and D. Raoult. 2003. Emerging rickettsioses of the Thai-Myanmar border. Emerg. Infect. Dis. 9:592-595.[Medline]
  46. 24
  47. Parola, P. 2004. Tick-borne rickettsial diseases: emerging risks in Europe. Comp. Immunol. Microbiol. Infect. Dis. 27:297-304.[CrossRef][Medline]
  48. 25
  49. Pusterla, N., J. Berger Pusterla, P. Deplazes, C. Wolfensberger, W. Müller, A. Hörauf, C. Reusch, and H. Lutz. 1998. Seroprevalence of Ehrlichia canis and of granulocytic Ehrlichia infection in dogs in Switzerland. J. Clin. Microbiol. 36:3460-3462.[Abstract/Free Full Text]
  50. 26
  51. Pusterla, N., C. C. Chang, B. B. Chomel, J. S. Chae, J. E. Foley, E. DeRock, V. L. Kramer, H. Lutz, and J. E. Madigan. 2000. Serologic and molecular evidence of Ehrlichia spp. in coyotes in California. J. Wildl. Dis. 36:494-499.[Abstract]
  52. 27
  53. Pusterla, N., P. Deplazes, U. Braun, and H. Lutz. 1999. Serological evidence of infection with Ehrlichia spp. in red foxes (Vulpes vulpes) in Switzerland. J. Clin. Microbiol. 37:1168-1169.[Abstract/Free Full Text]
  54. 28
  55. Pusterla, N., J. B. Huder, K. Feige, and H. Lutz. 1998. Identification of a granulocytic Ehrlichia strain isolated from a horse in Switzerland and comparison with other rickettsiae of the Ehrlichia phagocytophila genogroup. J. Clin. Microbiol. 36:2035-2037.[Abstract/Free Full Text]
  56. 29
  57. Pusterla, N., J. B. Huder, C. M. Leutenegger, U. Braun, J. E. Madigan, and H. Lutz. 1999. Quantitative real-time PCR for the detection of members of the Ehrlichia phagocytophila genogroup in host animals and Ixodes ricinus ticks. J. Clin. Microbiol. 37:1332-1334.[Abstract/Free Full Text]
  58. 30
  59. Read, S. M., and D. H. Northcote. 1981. Minimization of variation in the response to different proteins of the Coomassie blue G dye-binding assay for protein. Anal. Biochem. 116:53-64.[CrossRef][Medline]
  60. 31
  61. Reyna-Bello, A., A. Cloeckaert, N. Vizcaino, M. I. Gonzatti, P. M. Aso, G. Dubray, and M. S. Zygmunt. 1998. Evaluation of an enzyme-linked immunosorbent assay using recombinant major surface protein 5 for serological diagnosis of bovine anaplasmosis in Venezuela. Clin. Diagn. Lab. Immunol. 5:259-262.
  62. 32
  63. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, vol. 3, appendix A.2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  64. 33
  65. Santos, A. S., M. M. Santos-Silva, V. C. Almeida, F. Bacellar, and J. S. Dumler. 2004. Detection of Anaplasma phagocytophilum DNA in Ixodes ticks (Acari:Ixodidae) from Madeira Island and Stubal District, Mainland Portugal. Emerg. Infect. Dis. 10:1643-1648.[Medline]
  66. 34
  67. Strle, F. 2004. Human granulocytic ehrlichiosis in Europe. Int. J. Med. Microbiol. 37:27-35.
  68. 35
  69. Tassi, P., G. Carelli, and L. Ceci. 2002. Tick-borne diseases (TBDs) of dairy cows in a Mediterranean environment. Ann. N. Y. Acad. Sci. 969:314-317.[Medline]
  70. 36
  71. Teglas, M., E. Matern, S. Lein, P. Foley, P. Mahan, and J. Foley. 2005. Ticks and tick-borne disease in Guatemalan cattle and horses. Vet. Parasitol. 131:119-127.[CrossRef][Medline]
  72. 37
  73. Torioni de Echaide, S., D. P. Knowles, T. C. McGuire, G. H. Palmer, C. E. Suarez, and F. F. McElwain. 1998. Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J. Clin. Microbiol. 36:777-782.[Abstract/Free Full Text]
  74. 38
  75. Visser, E. S., T. C. McGuire, G. H. Palmer, W. C. Davis, V. Shkap, E. Pipano, and D. P. Knowles, Jr. 1992. The Anaplasma marginale msp5 gene encodes a 19-kilodalton protein conserved in all recognized Anaplasma species. Infect. Immun. 60:5139-5144.[Abstract/Free Full Text]
  76. 39
  77. Von Loewenich, F. D., G. Stumpf, B. U. Baumgarten, M. Röllinghoff, J. S. Dumler, and C. Bogdan. 2003. A case of equine granulocytic ehrlichiosis provides molecular evidence for the presence of pathogenic Anaplasma phagocytophilum (HGE agent) in Germany. Eur. J. Clin. Microbiol. Infect. Dis. 2:303-305.
  78. 40
  79. Wallace, B. J., G. Brady, D. M. Ackman, S. J. Wong, G. Jacquette, E. E. Lloyd, and G. S. Birkhead. 1998. Human granulocytic ehrlichiosis in New York. Arch. Intern. Med. 158:769-773.[Abstract/Free Full Text]
  80. 41
  81. Walls, J. J., B. Greig, D. F. Neitzel, and J. S. Dumler. 1997. Natural infection of small mammal species in Minnesota with the agent of human granulocytic ehrlichiosis. J. Clin. Microbiol. 35:853-855.[Abstract]
  82. 42
  83. Walls, J. J., K. M. Asanovich, J. S. Bakken, and J. S. Dumler. 1998. Serologic evidence of a natural infection of white-tailed deer with the agent of human granulocytic ehrlichiosis in Wisconsin and Maryland. Clin. Diagn. Lab. Immunol. 5:762-765.
  84. 43
  85. Zhou, C., Y. Yang, and A. Y. Jong. 1990. Miniprep in ten minutes. BioTechniques 8:172-173.[Medline]


Clinical and Vaccine Immunology, March 2007, p. 262-268, Vol. 14, No. 3
1071-412X/07/$08.00+0     doi:10.1128/CVI.00320-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Ge, Y., Rikihisa, Y. (2007). Identification of Novel Surface Proteins of Anaplasma phagocytophilum by Affinity Purification and Proteomics. J. Bacteriol. 189: 7819-7828 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Strik, N. I.
Right arrow Articles by Knowles, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Strik, N. I.
Right arrow Articles by Knowles, D. P.