This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borisova, O.
Right arrow Articles by Mooi, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borisova, O.
Right arrow Articles by Mooi, F. R.

 Previous Article  |  Next Article 

Clinical and Vaccine Immunology, March 2007, p. 234-238, Vol. 14, No. 3
1071-412X/07/$08.00+0     doi:10.1128/CVI.00294-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Antigenic Divergence between Bordetella pertussis Clinical Isolates from Moscow, Russia, and Vaccine Strains{triangledown}

Olga Borisova,1 Svetlana Yu Kombarova,1 Nelli S. Zakharova,3 Marjolein van Gent,2 Vladimir A. Aleshkin,1 Isabella Mazurova,1 and Frits R. Mooi2*

Russian Federal Diphtheria Reference Laboratory, G. N. Gabrichevsky Institute of Epidemiology and Microbiology, 10 Admiral Makarov Str., Moscow 125212, Russia,1 National Institute of Public Health and Environment, Laboratory for Vaccine-Preventable Diseases, P.O. Box 1, 3720 BA Bilthoven, The Netherlands,2 I. I. Mechnikov Institute Vaccine and Serum, 5a Kazenii per, Moscow 105064, Russia3

Received 20 August 2006/ Returned for modification 19 October 2006/ Accepted 20 December 2006


arrow
ABSTRACT
 
We analyzed temporal changes in the frequencies of the ptxA, prn, fim2, and fim3 alleles in Bordetella pertussis strains isolated from pertussis patients in Moscow, Russia, from 1948 to 2004. The three strains used for the whole-cell vaccine harbored the alleles ptxA2, ptxA4, prn1, fim2-1, and fim3A. Vaccine-type alleles of ptxA (ptxA2 and ptxA4) were characteristic for all prevaccination strains and for 96% of the strains isolated in the 1960s and 1970s. At the beginning of the 1970s, ptxA2 and ptxA4 were replaced by the ptxA1 allele. In the 1980s and to the present, strains with ptxA1 were predominant in the B. pertussis population. All prevaccination strains harbored the prn1 allele, which corresponds to the vaccine-type allele. In subsequent years, the proportion of strains with the prn1 allele decreased and the proportion of prn3 and prn2 strains increased. From 2002 to 2004 strains with prn2 or prn3 were predominant in the B. pertussis population. The vaccine-type alleles fim2-1 and fim3A were found in all prevaccination strains and in 92% of the strains isolated from 1960 to 1989. The fim2-2 and fim3B alleles were first observed at the beginning of the 1980s. In subsequent years, these strains became predominant. Together with waning immunity, the antigenic divergence between vaccine strains and clinical isolates observed in the Moscow area may explain the persistence of pertussis, despite the high rates of vaccine coverage. The results demonstrate that the selection of B. pertussis strains for vaccine manufacturing must be based on a thorough study of the B. pertussis population.


arrow
INTRODUCTION
 
In the prevaccination era, pertussis was one of the four leading airborne infections in Russia, along with measles, scarlet fever, and diphtheria. Vaccination for the prevention of pertussis was introduced nationwide in Russia between 1958 and 1960. This subsequently resulted in a significant decrease in the incidence and the severity of the disease. Decreased vaccine uptake, due to concerns about the side effects of pertussis whole-cell vaccines, has resulted in large pertussis outbreaks in the United Kingdom and Japan (1, 11). These experiences clearly indicate that the morbidity and mortality due to pertussis in children far outweigh the risk of postvaccination complications. Infants in Russia are vaccinated with a whole-cell pertussis vaccine (diphtheria, pertussis, and tetanus [DPT] vaccine) at the ages of 3, 4.5, 6, and 18 months. Epidemiological data from Russia have shown that the whole-cell vaccine currently used is not sufficiently effective. We have observed seasonal peaks, periodic increases in incidence, as well as infection clusters in schools and day care facilities. Thus, children who have received a complete vaccination may be susceptible (8). The adverse reactions caused by whole-cell pertussis vaccines have prompted researchers in many countries to develop new, acellular pertussis vaccines. To date, however, an acellular vaccine has not been used in Russia to immunize children.

In the past few years, the pertussis epidemiological situation in Russia has been unfavorable. Regardless of the high rates of vaccination coverage for pertussis, we have registered an increase in the incidence of pertussis among school-aged children, along with persistently high incidences among infants under 12 months of age. In addition, some cases of pertussis have been registered among vaccinated children (8, 23). Similar trends have been observed in many other countries (1, 2, 5, 6, 10). Researchers point to many reasons for the increased incidence of pertussis, including improved surveillance, waning immunity, and pathogen adaptation. The last possibility is supported by the fact that divergence in the protective antigens pertussis toxin (Ptx) and pertactin (Prn) has been observed between vaccine strains and the strains circulating in many countries (2, 7, 9, 12, 13, 17, 18, 20, 24, 31-33). In general, it was found that "non-vaccine-type" alleles of ptxA and prn (i.e., ptxA1, prn2, and prn3) have gradually replaced the "vaccine-type" alleles (i.e., ptxA2, ptxA4, and prn1) that were in circulation earlier. Analysis of strains isolated in Russia (Moscow and St. Petersburg) from 1998 to 2002 also revealed that strains with the ptxA1 and the prn2 or prn3 alleles prevailed in circulation (12, 14). Possible variations in nucleotide sequences in 15 other genes encoding surface-exposed proteins have also been studied. Polymorphisms were found in the bipA, fhaB, fim2, fim3, ompQ, ptxS3, tcfA, and vag8 genes; but they are especially manifest in ptxA, prn, and tcfA (20, 27, 30, 31).

Here we present data on the polymorphisms in four genes, ptxA, prn, fim2, and fim3, among Bordetella pertussis strains isolated before and after the introduction of vaccination in Moscow. Clinical isolates were compared with the strains used for vaccine production in Russia.


arrow
MATERIALS AND METHODS
 
Bacterial strains and culture conditions. We studied 62 B. pertussis strains isolated in Moscow from 2002 to 2004, as well as 96 B. pertussis strains isolated from 1948 to 1999 (from the collection of Gabrichevsky Institute of Epidemiology and Microbiology, Moscow, Russia) and the three vaccine strains currently used to manufacture the DPT vaccine in Russia (Table 1). The strains were grown on casein-charcoal agar with 10% sheep blood for 3 to 5 days at 36°C. Serotyping was performed with polyclonal rabbit antisera to agglutinogens 1, 2, and 3 (Gamelei Institute of Epidemiology and Microbiology, Moscow, Russia) in a slide agglutination assay.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Characteristics of the B. pertussis strains used in this study

Genotyping. DNA isolation, ptxA gene amplification, and sequencing of the B. pertussis strains were done as described previously (16, 18). Polymorphism in the prn gene was studied by PCR-based methods (19), and prn gene sequencing was done as described previously (16). The coordinates of the primers are based on the published genome sequence of the Tohama I strain (GenBank accession number NC_002929). The sequencing of the fim2 and fim3 genes of the B. pertussis strains was performed as follows. PCR amplification and sequencing of chromosomal DNA or bacterial lysate were performed by adding 1 µl DNA or lysate to 19 µl of a PCR mixture. For fim2, the PCR mixture consisted of 50% HotstarTaq Mastermix (QIAGEN), 4 µl 5 M betain (Sigma-Aldrich), 10 pmol PCR primer F (GCGCCGGGCCCTGCATGCAC; coordinates 1176626 to 1176607), 10 pmol of primer R (GGGGGGTTGGCGATTTCCAGTTTCTC; coordinates 1170431 to 1170406), and 3 µl H2O. Thermal cycling for fim2 was as follows: 15 min at 95°C and 30 cycles of 30 s at 95°C, 30 s at 65°C, and 1 min at 72°C. A final extension was performed for 10 min at 72°C. For fim3, the PCR mixture consisted of 50% HotstarTaq Mastermix (QIAGEN), 5% dimethyl sulfoxide (ICN), 10 pmol PCR primer F (GACCTGATATTCTGATGCCG; coordinates 1647541 to 1647560), 10 pmol of primer R (CGCAAGGCTTGCCGGTTTTTTTTGG; coordinates 1648255 to 1648231), and 6 µl H2O. Thermal cycling of fim3 was as follows: 15 min at 95°C and 30 cycles of 30 s at 95°C, 30 s at 56°C, and 1 min at 72°C. A final extension was performed for 10 min at 72°C. The fim2 and fim3 PCR products were purified with ExoSap-IT (U.S. Biochemicals, Cleveland, OH) and sequenced with the same forward and reverse primers used for amplification. The sequencing reactions were performed with an ABI Prism BigDye Terminator reaction kit, and the reaction products were analyzed with a model 3700 ABI DNA sequencer (Perkin-Elmer Applied Biosystems). Sequence trace data were analyzed by using the Kodon program (Applied Maths, Sint-Martens-Latem, Belgium). The nucleotide sequences of the alleles in the ptxA, prn, fim2, and fim3 genes of the B. pertussis strains were compared with sequences in the EMBL/GenBank database.


arrow
RESULTS AND DISCUSSION
 
Epidemiology of pertussis in Moscow. The area of Moscow studied encompasses 1,081 square kilometers and harbors a population of approximately 11 million people. The incidence rate (IR) of pertussis per 100,000 persons was 574 in the year that vaccination was introduced (Fig. 1). After the introduction of pertussis vaccination, IRs decreased, although in the first 9 years of mass immunization, some sharp increases in IRs were observed (IRs, 152 and 153 in 1961 and 1966, respectively), as were sharp decreases (IRs, 36 and 35 in 1963 and 1964, respectively). Between 1970 and 1979, IRs of pertussis infection stabilized (IRs, 53 and 19 in 1976 and 1978, respectively). This period was characterized by a slow decrease in IRs, with periodic peaks every 2 years. It is important to mention that the decreased IRs in the 1970s in Moscow were occurring against a backdrop of reduced vaccine coverage. An increase in IRs was observed in the 1980s, presumably an effect of the decreased vaccine coverage mentioned earlier (8, 23, 25) (Fig. 1). In the 1980s, high IRs were registered in 1985 and 1988 (IRs, 186 and 140, respectively). Epidemics in the middle and late 1990s were less intense than those in the early and mid-1980s (4). Periodic peaks and troughs in the incidence of pertussis were then occurring against the backdrop of a sufficiently high rate of vaccination (DPT vaccine) coverage among 6- to 12-month-old children (Fig. 1). In the 1990s and 2000s, the rate of vaccine coverage increased from 33% in 1991 to 96% in 2004. In 2004, the percentage of children who had received a booster for pertussis by the age of 4 years was 96%. The booster at 18 months of age was given on time for 95% of the cases. Despite the high vaccine coverage rate, the average IR for the years from 2000 to 2004 was 35 (Fig. 1). We studied 158 B. pertussis strains isolated from pertussis patients. Of these, 13 strains were isolated from patients in prevaccination periods (1948 to 1959), 20 strains were isolated from 1960 to 1969, 28 strains were isolated from 1970 to 1979, 27 strains were isolated from 1980 to 1989, 8 strains were isolated from 1990 to 1999, and 62 strains were isolated from 2002 to 2004 (Table 1).


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 1. Vaccination coverage (lines) and pertussis incidence rates (columns) in Moscow from 1958 to 2004. Vaccination was introduced in 1958.

Temporal trends in serotype frequencies. The three B. pertussis vaccine strains were of serotypes 2.3, 3, and 2; i.e., they expressed Fim2 and Fim3, Fim3 only, or Fim2 only, respectively. Serotyping with polyclonal sera showed that all B. pertussis strains isolated during the prevaccination period belonged to serotype 2.3 (Fig. 2). After the introduction of vaccination, serotype 2.3 strains were gradually replaced by serotype 3 strains. The frequencies of the serotype 3 strains were 35%, 82%, 81%, 50%, and 76% in the periods 1960 to 1969, 1970 to 1979, 1980 to 1989, 1990 to 1999, and 2000 to 2004, respectively. The increase in the frequency of serotype 3 after the introduction of vaccination has been described before and has been attributed to the lower immunogenicity of Fim3 and to the higher level of cross-reacting antibodies induced by Fim3 than by Fim2 (21, 22). Serotypes 0 and 2 were found at low frequencies (0% to 13%) throughout the whole period.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 2. Temporal trends in serotypes and alleles for pertussis toxin, pertactin, and fimbriae in Moscow.

Temporal trends in frequencies of ptxA, prn, fim2, and fim3 alleles. Among the B. pertussis strains that we studied, ptxA gene sequencing yielded three allelic variants identified previously, ptxA1, ptxA2, and ptxA4 (16). The vaccine strains harbored the alleles ptxA2 and ptxA4. The presence of the ptxA2 or the ptxA4 allele was characteristic of B. pertussis strains isolated in the prevaccination period (1948 to 1959), when they were found at frequencies of 38% and 62%, respectively (Fig. 2). The ptxA1 allele was first detected from 1970 to 1979 (frequency, 11%), and the frequency of detection increased to 100% from 1980 to 1989 and subsequent periods.

Three prn alleles were identified in this study: prn1, prn2, and prn3 (16). The vaccine strains harbored the prn1 allele. The prn1 allele was found at a frequency of 100% in 1948 and from 1960 to 1969 (Fig. 2). In subsequent periods it gradually decreased in frequency to the low level of 2% from 2000 to 2004. The prn3 allele was first observed from 1970 to 1979 (frequency, 7%). In the subsequent periods, 1980 to 1989, 1990 to 1999, and 2000 to 2004, it was found at frequencies of 19%, 38%, and 29%, respectively. The prn2 allele was first detected from 1980 to 1989 (frequency, 11%) and increased in frequency in the periods from 1990 to 1999 (25%) and 2000 to 2004 (70%).

The characteristics of B. pertussis strains isolated in Moscow with respect to serotype and the ptxA and prn alleles agree with the data obtained from the analysis of B. pertussis strains isolated in St. Petersburg, Russia (12, 29).

There is a paucity of data on polymorphisms in the serotype 2 and 3 fimbrial genes, although the levels of antibodies against fimbriae have been implicated in protective immunity (3, 15, 26). Two fim2 alleles (fim2-1 and fim2-2) and two fim3 alleles (fim3A and fim3B) have been identified in B. pertussis populations (27, 31). The Russian vaccine strains were found to harbor fim2-1 and fim3A. These alleles were found at frequencies of 100% from 1948 to 1959. In the subsequent period, 1960 to 1989, fim2-2 and fim3B were found at low frequencies (8% for both alleles). In the next period analyzed, 1990 to 1994, fim2-2 and fim3B rose to predominance (frequencies, 89% and 64%, respectively). Shifts in fim2 alleles have been observed in the United Kingdom (20). When 80 strains isolated in the United Kingdom between 1920 and 2002 were studied, 75% were found to harbor fim2-1 and 25% were found to harbor fim2-2. The United Kingdom vaccine strains harbored fim2-1, and the fim2-2 allele was not found in isolates prior to 1998. Temporal trends in the frequencies of the fim3 alleles have been studied in Canada, where fim3B was detected in 1994, although isolates from earlier periods were not analyzed (27, 28).

Despite a high vaccination coverage rate in Moscow of 87% to 96% from 2000 to 2004, the average IRs were 35 and 224 for all age categories and those 0 to 14 years old, respectively. The antigenic divergence between vaccine strains and circulating strains may have contributed to the persistence of pertussis in Moscow, despite high rates of vaccine coverage. The mismatch between vaccine strains and clinical isolates raises the possibility that the current vaccine can be improved by the use of modern strains. However, it should be noted that waning immunity may also be an important cause for the reemergence of pertussis in Moscow, and pertussis vaccines which induce long-term immunity could reduce the pertussis burden significantly. The results obtained by us clearly demonstrate that the process of selection of B. pertussis strains for vaccine manufacture must be based on a thorough study of the B. pertussis population. Analyses of polymorphisms in B. pertussis genes other than those investigated here remain an important area of research. Such analyses will allow the identification of the evolutionary changes in B. pertussis which allow it to persist in immunized populations.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: National Institute of Public Health and Environment, Laboratory for Vaccine-Preventable Diseases, P.O. Box 1, 3720 BA Bilthoven, The Netherlands. Phone: 31-302743091. Fax: 31-302744449. E-mail: fr.mooi{at}rivm.nl. Back

{triangledown} Published ahead of print on 3 January 2007. Back


arrow
REFERENCES
 
    1
  1. Bass, J. W., and R. R. Wittler. 1994. Return of epidemic pertussis in the United States. Pediatr. Infect. Dis. J. 13:343-345.[Medline]
  2. 2
  3. Cassiday, P., G. Sanden, K. Heuvelman, F. Mooi, K. M. Bisgard, and T. Popovic. 2000. Polymorphism in Bordetella pertussis pertactin and pertussis toxin virulence factors in the United States, 1935-1999. J. Infect. Dis. 182:1402-1408.[CrossRef][Medline]
  4. 3
  5. Cherry, J. D., J. Gornbein, U. Heininger, and K. Stehr. 1998. A search for serologic correlates of immunity to Bordetella pertussis cough illnesses. Vaccine 16:1901-1906.[CrossRef][Medline]
  6. 4
  7. Chistyakova, G. G., O. Borisova, I. N. Lytkina, I. K. Mazurova, Y. S. Komborova, A. S. Petrova, A. M. Melnikova, and V. G. Skachkova. 2005. Specific features of the epidemic process of pertussis infection in Moscow. J. Microbiol. (Moscow) 5:35-40.
  8. 5
  9. de Melker, H. E., J. F. Schellekens, S. E. Neppelenbroek, F. R. Mooi, H. C. Rumke, and M. A. Conyn-van Spaendonck. 2000. Reemergence of pertussis in the highly vaccinated population of The Netherlands: observations on surveillance data. Emerg. Infect. Dis. 6:348-357.[Medline]
  10. 6
  11. De Serres, G., N. Boulianne, F. M. Douville, and B. Duval. 1995. Pertussis in Quebec: ongoing epidemic since the late 1980s. Can. Commun. Dis. Rep. 21:45-48.[Medline]
  12. 7
  13. Fry, N. K., S. Neal, T. G. Harrison, E. Miller, R. Matthews, and R. C. George. 2001. Genotypic variation in the Bordetella pertussis virulence factors pertactin and pertussis toxin in historical and recent clinical isolates in the United Kingdom. Infect. Immun. 69:5520-5528.[Abstract/Free Full Text]
  14. 8
  15. Gerasimova, A., M. S. Petrova, and N. T. Tikhonova. 2004. Clinico-epidemiological characteristic of the pertussis. Bull. Vaccine (Moscow) 5(35):4-5.
  16. 9
  17. Guiso, N., C. Boursaux-Eude, C. Weber, S. Z. Hausman, H. Sato, M. Iwaki, K. Kamachi, T. Konda, and D. L. Burns. 2001. Analysis of Bordetella pertussis isolates collected in Japan before and after introduction of acellular pertussis vaccines. Vaccine 19:3248-3252.[CrossRef][Medline]
  18. 10
  19. Guris, D., P. M. Strebel, B. Bardenheier, M. Brennan, R. Tachdjian, E. Finch, M. Wharton, and J. R. Livengood. 1999. Changing epidemiology of pertussis in the United States: increasing reported incidence among adolescents and adults, 1990-1996. Clin. Infect. Dis. 28:1230-1237.[Medline]
  20. 11
  21. Kanai, K. 1980. Japan's experience in pertussis epidemiology and vaccination in the past thirty years. Jpn. J. Med. Sci. Biol. 33:107-143.[Medline]
  22. 12
  23. Kourova, N., V. Caro, C. Weber, S. Thiberge, R. Chuprinina, G. Tseneva, and N. Guiso. 2003. Comparison of the Bordetella pertussis and Bordetella parapertussis isolates circulating in Saint Petersburg between 1998 and 2000 with Russian vaccine strains. J. Clin. Microbiol. 41:3706-3711.[Abstract/Free Full Text]
  24. 13
  25. Mastrantonio, P., P. Spigaglia, H. van Oirschot, H. G. van der Heide, K. Heuvelman, P. Stefanelli, and F. R. Mooi. 1999. Antigenic variants in Bordetella pertussis strains isolated from vaccinated and unvaccinated children. Microbiology 145(Pt 8):2069-2075.[Abstract/Free Full Text]
  26. 14
  27. Mazurova, I. K., O. I. Borisova, S. I. Kombarova, N. S. Zakharova, and V. A. Aleshkin. 2005. Molecular genetic characteristics of the B. pertussis strains isolated in different periods of the pertussis epidemic process. J. Mol. Genet. Microbiol. Virol. (Moscow) 4:21-25.
  28. 15
  29. Miller, J. J., R. Silverberg, T. M. Saito, and J. B. Umber. 1943. An agglutinative reaction for Hemophilus pertussis. II. Its relation to clinical immunity. J. Pediatr. 22:644-651.
  30. 16
  31. Mooi, F. R., H. Hallander, C. H. Wirsing von Konig, B. Hoet, and N. Guiso. 2000. Epidemiological typing of Bordetella pertussis isolates: recommendations for a standard methodology. Eur. J. Clin. Microbiol. Infect. Dis. 19:174-181.[CrossRef][Medline]
  32. 17
  33. Mooi, F. R., Q. He, H. van Oirschot, and J. Mertsola. 1999. Variation in the Bordetella pertussis virulence factors pertussis toxin and pertactin in vaccine strains and clinical isolates in Finland. Infect. Immun. 67:3133-3134.[Abstract/Free Full Text]
  34. 18
  35. Mooi, F. R., H. van Oirschot, K. Heuvelman, H. G. van der Heide, W. Gaastra, and R. J. Willems. 1998. Polymorphism in the Bordetella pertussis virulence factors P. 69/pertactin and pertussis toxin in The Netherlands: temporal trends and evidence for vaccine-driven evolution. Infect. Immun. 66:670-675.[Abstract/Free Full Text]
  36. 19
  37. Muyldermans, G., D. Pierard, N. Hoebrekx, R. Advani, S. Van Amersfoorth, I. De Schutter, O. Soetens, L. Eeckhout, A. Malfroot, and S. Lauwers. 2004. Simple algorithm for identification of Bordetella pertussis pertactin gene variants. J. Clin. Microbiol. 42:1614-1619.[Abstract/Free Full Text]
  38. 20
  39. Packard, E. R., R. Parton, J. G. Coote, and N. K. Fry. 2004. Sequence variation and conservation in virulence-related genes of Bordetella pertussis isolates from the UK. J. Med. Microbiol. 53:355-365.[Abstract/Free Full Text]
  40. 21
  41. Preston, N. W. 1985. Essential immunogens in human pertussis: the role of fimbriae. Dev. Biol. Stand. 61:137-141.[Medline]
  42. 22
  43. Robinson, A., A. R. Gorringe, S. G. Funnell, and M. Fernandez. 1989. Serospecific protection of mice against intranasal infection with Bordetella pertussis. Vaccine 7:321-324.[CrossRef][Medline]
  44. 23
  45. Selezneva, T. T., and N. S. Titova. 2002. Influence of vaccination on the epidemic process of infections in Russia. J. Epidemiol. Infect. Dis. (Moscow) 2:6-11.
  46. 24
  47. Semenov, B. F., N. S. Zakharova, and I. K. Mazurova. 2003. Increased pertussis morbidity in the background of mass vaccination. Hypotheses explaining this phenomenon. J. Microbiol. (Moscow) 6:70-73.
  48. 25
  49. Sigaeva, L. A., R. G. Petrova, and R. G. Shakirova. 1990. Performance of epidemiological surveillance of whooping-cough, p. 95-102. In Epidemiological surveillance as a basis for prevention of intestine infections. Ministry of Health of Russia, Moscow, Russia.
  50. 26
  51. Storsaeter, J., H. O. Hallander, L. Gustafsson, and P. Olin. 1998. Levels of anti-pertussis antibodies related to protection after household exposure to Bordetella pertussis. Vaccine 16:1907-1916.[CrossRef][Medline]
  52. 27
  53. Tsang, R. S., A. K. Lau, M. L. Sill, S. A. Halperin, P. Van Caeseele, F. Jamieson, and I. E. Martin. 2004. Polymorphisms of the fimbria fim3 gene of Bordetella pertussis strains isolated in Canada. J. Clin. Microbiol. 42:5364-5367.[Abstract/Free Full Text]
  54. 28
  55. Tsang, R. S., M. L. Sill, I. E. Martin, and F. Jamieson. 2005. Genetic and antigenic analysis of Bordetella pertussis isolates recovered from clinical cases in Ontario, Canada, before and after the introduction of the acellular pertussis vaccine. Can. J. Microbiol. 51:887-892.[CrossRef][Medline]
  56. 29
  57. Tseneva, G., and N. Kourova. 2003. Microbiological characteristic of Bordetella pertusis and laboratory diagnosis. J. Clin. Microbiol. Antimicrob. Ther. 4:329-341.
  58. 30
  59. van Amersfoorth, S. C., L. M. Schouls, H. G. van der Heide, A. Advani, H. O. Hallander, K. Bondeson, C. H. von Konig, M. Riffelmann, C. Vahrenholz, N. Guiso, V. Caro, E. Njamkepo, Q. He, J. Mertsola, and F. R. Mooi. 2005. Analysis of Bordetella pertussis populations in European countries with different vaccination policies. J. Clin. Microbiol. 43:2837-2843.[Abstract/Free Full Text]
  60. 31
  61. van Loo, I. H., K. J. Heuvelman, A. J. King, and F. R. Mooi. 2002. Multilocus sequence typing of Bordetella pertussis based on surface protein genes. J. Clin. Microbiol. 40:1994-2001.[Abstract/Free Full Text]
  62. 32
  63. van Loo, I. H., H. G. van der Heide, N. J. Nagelkerke, J. Verhoef, and F. R. Mooi. 1999. Temporal trends in the population structure of Bordetella pertussis during 1949-1996 in a highly vaccinated population. J. Infect. Dis. 179:915-923.[CrossRef][Medline]
  64. 33
  65. Weber, C., C. Boursaux-Eude, G. Coralie, V. Caro, and N. Guiso. 2001. Polymorphism of Bordetella pertussis isolates circulating for the last 10 years in France, where a single effective whole-cell vaccine has been used for more than 30 years. J. Clin. Microbiol. 39:4396-4403.[Abstract/Free Full Text]


Clinical and Vaccine Immunology, March 2007, p. 234-238, Vol. 14, No. 3
1071-412X/07/$08.00+0     doi:10.1128/CVI.00294-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Litt, D. J., Neal, S. E., Fry, N. K. (2009). Changes in Genetic Diversity of the Bordetella pertussis Population in the United Kingdom between 1920 and 2006 Reflect Vaccination Coverage and Emergence of a Single Dominant Clonal Type. J. Clin. Microbiol. 47: 680-688 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borisova, O.
Right arrow Articles by Mooi, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borisova, O.
Right arrow Articles by Mooi, F. R.