CVI
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Videa, E.
Right arrow Articles by Harris, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Videa, E.
Right arrow Articles by Harris, E.

 Previous Article  |  Next Article 

Clinical and Diagnostic Laboratory Immunology, July 2005, p. 882-884, Vol. 12, No. 7
1071-412X/05/$08.00+0     doi:10.1128/CDLI.12.7.882-884.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Immunoglobulin M Enzyme-Linked Immunosorbent Assay Using Recombinant Polypeptides for Diagnosis of Dengue

Elsa Videa,1 Maria Josefina Coloma,2 Flavia Barreto dos Santos,3 Angel Balmaseda,1 and Eva Harris2*

Virology Laboratory, Centro Nacional de Diagnóstico y Referencia, Ministry of Health, Managua, Nicaragua,1 Division of Infectious Diseases, School of Public Health, University of California, Berkeley, California,2 Flavivirus Laboratory, Department of Virology, Oswaldo Cruz Institute, Rio de Janeiro, Brazil3

Received 19 January 2005/ Returned for modification 4 April 2005/ Accepted 19 April 2005


   ABSTRACT
Top
 Abstract
Text
 References
 
We demonstrate that a mixture of four recombinant dengue virus E polypeptides corresponding to the N-terminal region of the envelope protein from all serotypes substitutes for standard antigens in two immunoglobulin M enzyme-linked immunosorbent assay formats with 100% concordance, making these polypeptides a useful and accessible reagent for serological diagnosis of dengue in endemic countries.


   TEXT
Top
 Abstract
 Text
References
 
Dengue is a major global public health problem with increasing numbers of cases and expanded geographic distribution (5). The four serotypes of the dengue flavivirus (DENV1 through DENV4) have a positive-sense RNA genome that is translated as a single polyprotein and posttranslationally cleaved into three structural proteins and seven nonstructural proteins (8). The envelope protein (E) is considered to be the immunodominant protein (10).

Large-scale dengue diagnosis relies on serological testing. While analysis of the change in immunoglobulin M (IgM) or IgG antibody titer in paired acute- and convalescent-phase sera is considered the "gold standard," in practice, the most commonly used diagnostic test is the IgM capture enzyme-linked immunosorbent assay (MAC-ELISA) (13) with a single specimen. Viral antigen, commonly prepared in cell culture or in suckling mouse brain, is often the limiting reagent in developing countries in which in-house ELISAs are used instead of expensive commercial kits. The simplified production of recombinant DENV antigen in bacteria avoids problems associated with the quality and standardization of conventional DENV antigen preparations (2, 4, 7, 9, 11, 14). Previously, we identified and produced a candidate diagnostic polypeptide corresponding to the N-terminal portion (166 amino acids) of the immunogenic E protein of DENV2 (3). Here, we produced homologous recombinant E antigens from DENV1, DENV3, and DENV4, which, in combination with the DENV2 polypeptide, have great potential as a low-cost and accessible tetravalent dengue diagnostic reagent.

A ~500-bp fragment from the N terminus (nucleotides 1093 through 1585) of the DENV E gene was amplified by reverse transcriptase PCR (3) using specific primers for each serotype (D1E-F [GTCGGATCCCCTGCCGTCCTGCGCAAACTGTG] and D1E-R [GGGCTGCAGTCATAAGTCTAGAAACCATTGTTTGTG], D3E-F [GCCGGATCCCTGGCGACCCTAAGGAAGCTATG] and D3E-R [GGGCTGCAGTCAGTCAAAGAACCATTGTCTATG], and D4E-F [GCCGGATCCGTGGCTCTGTTAAGAACCTATTG] and D4E-R [GGGCTGCAGTCAATTCAAAAACCATTGCTTATG]), inserted into a TA cloning vector (Invitrogen, Carlsbad, CA) (3), and sequenced. The identities of the products were confirmed by comparison to known sequences (GenBank). The cDNAs were then cloned in-frame into the pQE-30 expression vector (3) immediately downstream of the hexahistidine tag.

Expression of the recombinant polypetide clones in transformed Escherichia coli M15 was assessed by induction with 1 mM isopropyl-D-thiogalactoside (IPTG) and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of aliquots at various time points. Large-scale expression of the expected ~20-kDa recombinant proteins (200 ml Super-Broth) yielded enough soluble protein for nickel affinity purification. Bacterial lysis and binding to affinity resin were conducted under denaturing conditions, whereas elutions were performed under native conditions, according to the protocol previously established for DENV2 (Fig. 1A) (3). DENV2 clone pD2-3 (3) was used to prepare the DENV2 E polypeptide.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 1. Purification and evaluation of DENV E polypeptides. (A) SDS-PAGE analysis of fractions eluted from nickel affinity chromatography containing the DENV1, DENV3, and DENV4 ~20-kDa E polypeptides induced with 1 mM IPTG in E. coli M15 transformed with the pQE-30 expression plasmids. (B) Western blot. Two micrograms of DENV1, DENV3, and DENV4 E peptides were separated by SDS-PAGE, transferred to a nitrocellulose membrane, and incubated with serum from an acute-phase dengue patient with DENV-specific IgM antibodies. (C) Dot blot. Serial dilutions (starting at 1 µg/ml) of individual or a mixture of the four recombinant E peptides were applied to a nitrocellulose membrane and exposed to acute-phase dengue serum containing DENV-specific IgM antibodies. Bovine serum albumin (BSA) was used as a negative control.

 
The specificity of the polypeptides was tested by Western blot analysis as described before (3) with minor modifications, using sera from Nicaraguan dengue patients and polyclonal anti-E antibodies. Two acute-phase sera (with high and low titers of anti-DENV IgM), one convalescent-phase serum sample (high anti-DENV IgG titer), rabbit anti-E antibodies, and a serum sample negative for anti-DENV IgM were tested. The positive sera (Fig. 1B) and the polyclonal antibodies recognized all the recombinant polypeptides, while the negative control did not (data not shown). The sensitivities of the individual polypeptides were compared to that of a mixture of the four by dot blot using serial dilutions of each antigen. Serum known to contain anti-DENV IgM recognized the mixture of the four recombinant antigens at a dilution of 1:15 (66 ng/ml), whereas the thresholds of detection of single polypeptides ranged from 100 to 200 ng/ml (Fig. 1C).

The performance of the novel tetravalent polypeptides was compared to that of antigen prepared from infected cell lysates (cellular antigen) in a modified in-house MAC-ELISA (1). Briefly, plates coated with anti-human IgM (Sigma Chemical Co., St. Louis, MO) were incubated with 1:20 dilutions of serum samples, followed by the tetravalent recombinant polypeptides (30 µg/ml) and then the secondary antibody (anti-DENV IgG-peroxidase conjugate prepared from hyperimmune sera) diluted 1:5,000. The reaction with substrate tetramethylbenzidine (Sigma) was stopped with 2.5% sulfuric acid after 30 min. Negative controls consisted of sera from healthy donors confirmed as being negative for DENV-specific antibodies by ELISAs using cellular antigen (6), while positive controls were sera from patients serologically confirmed as being positive for anti-DENV IgM by MAC-ELISA (6). These sera were collected during a period when DENV2, DENV3, and DENV4 were circulating in Nicaragua. Fifteen acute-phase sera, 15 convalescent-phase sera, 11 sera from yellow fever (YF) vaccinees, and 10 sera positive for anti-rubella IgM were tested. An excellent correlation between the two assays was found (R2 = 0.98), with 14 of the 15 acute-phase sera defined as positive and 1 as negative by both assays. Likewise, 11 convalescent-phase serum samples were positive and 4 were negative by ELISA with either antigen. None of the YF-vaccinated or rubella-positive sera were positive by either assay (Fig. 2A).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 2. Comparison of tetravalent E polypeptides with conventional antigens in ELISA assays. (A) IgM capture ELISA. The results obtained using cellular antigen and a mixture of the four DENV E polypeptides as an antigen were plotted against each other. Acute-phase sera (taken within the first 7 days since the onset of symptoms) and convalescent-phase sera (taken 8 or more days since symptom onset) from suspected dengue cases and sera from YF vaccinees and from rubella-positive cases were tested. The sera from YF vaccinees were a gift of X. Aguilar, Universidad Mayor de San Andrés, La Paz, Bolivia; the rest were samples sent to the Virology Laboratory at the Centro Nacional de Diagnóstico y Referencia, Nicaraguan Ministry of Health, for routine testing for either dengue or rubella. Cutoff values were 0.160 for E polypeptides and 0.106 for cellular antigen. (B) Indirect IgM ELISA. Tetravalent recombinant E polypeptides were compared with three different antigens: DENV2 recombinant E protein (Recomb. E), antigen from DENV1 through DENV4 produced in suckling mouse brain (mouse brain Ag), and antigen produced by lysis of cultured C6/36 cells infected with DENV1 through DENV4 (cellular Ag). Cut-off values were 0.145 for E polypeptides, 0.138 for recombinant E protein, 0.160 for mouse brain antigen, and 0.164 for cellular antigen. For both assays, the cutoff was twice the average optical density (OD) (450/630 nm) of the negative controls (included in triplicate per plate). R2 analysis of correlation was performed with Excel. Chi-square analysis conducted using Epi-Info (Centers for Disease Control and Prevention) yielded a P value of <0.001 for comparison of results obtained with the E polypeptides versus each of the other DENV antigens.

 
An indirect IgM ELISA (6) with antigen bound to the polystyrene plate was evaluated by using four sources of antigen (the four recombinant E polypeptides, DENV2 recombinant E protein, cellular antigen [DENV1 through DENV4] [1], and mouse brain antigen [DENV1 through DENV4] [Instituto de Medicina Tropical Pedro Kouri, Havana, Cuba]). Recombinant E protein was expressed from baculovirus AcD2E{Delta}H6 in Sf9 cells and purified as described previously (12). Human rheumatoid factors (anti-IgG IgM antibodies) were removed from all serum specimens (previously diluted 1:20) by pretreatment with a 1:5 dilution of anti-human IgG (Sigma). For the ELISA, plates were coated with 2.5 µg/ml of each antigen and blocked with 3% nonfat dry milk. Serum samples were incubated for 1 h at 37°C, followed by incubation with a goat anti-human IgM-horseradish peroxidase conjugate (Sigma) diluted 1:5,000 in blocking buffer, and detected with tetramethylbenzidine as described above. Three washes with phosphate-buffered saline-Tween followed each step. Twelve acute-phase sera previously confirmed as positive, 5 convalescent-phase sera previously confirmed as negative for DEN-specific IgM antibodies, 6 sera from YF vaccinees, and 10 rubella-positive sera were tested in all assays in triplicate. The acute-phase sera were positive for IgM antibodies with all three antigens, whereas the convalescent-phase, YF-vaccinated, and rubella-positive control sera were negative in all ELISAs (Fig. 2B and data not shown). Correlations (R2) of 0.91, 0.90, and 0.84 were obtained by comparing the four E polypeptides with recombinant E protein, mouse brain antigen, and cellular antigen, respectively. The polypeptides and standard cellular antigen discriminated between positive and negative samples with 100% concordance (Fig. 2B). Both the DENV polypeptides and cellular antigen were more specific than recombinant E or mouse brain antigen, each of which detected one low false positive from YF-vaccinated serum samples (Fig. 2B).

Routine diagnosis of dengue is performed predominantly by IgM capture ELISA, which requires large amounts of DENV antigen produced in mouse brain or cell culture, often unavailable in laboratories across the developing world. We have produced an alternate source of DENV antigen by expressing in E. coli a recombinant fragment of the E protein from all four DENV serotypes that, according to our calculations, costs approximately one-half as much to prepare as does cellular antigen. Our data suggest that a tetravalent preparation of the recombinant DENV E polypeptides can be used as a substitute for the traditional DENV antigens in a MAC-ELISA and indirect ELISA format.


   ACKNOWLEDGMENTS
 
We thank Vincent Deubel (Institut Pasteur, Paris, France) for baculovirus AcD2E{Delta}H6, Sujan Shresta (School of Public Health, University of California, Berkeley, Calif.) for recombinant E protein, Ximena Aguilar (Universidad Mayor de San Andrés, La Paz, Bolivia) for the yellow fever vaccinee serum specimens from Bolivia, and Yoryelin Rodriguez (Ministry of Health, Nicaragua) for her help with the expression and purification of the polypeptides.

This research was supported by Fogarty International Center grant TW-00905.


   FOOTNOTES
 
* Corresponding author. Mailing address: Division of Infectious Diseases, School of Public Health, 140 Warren Hall, University of California, Berkeley, CA 94720-7360. Phone: (510) 642-4845. Fax: (510) 642-6350. E-mail: eharris{at}socrates.berkeley.edu. Back


   REFERENCES
Top
 Abstract
 Text
 References
 

  1. Balmaseda, A., M. G. Guzman, S. Hammond, G. Robleto, C. Flores, Y. Tellez, E. Videa, S. Saborio, L. Perez, E. Sandoval, Y. Rodriguez, and E. Harris. 2003. Diagnosis of dengue virus infection by detection of specific immunoglobulin M (IgM) and IgA antibodies in serum and saliva. Clin. Diagn. Lab. Immunol. 10:317-322.[Abstract/Free Full Text]
  2. Cuzzubbo, A. J., T. P. Endy, A. Nisalak, S. Kalayanarooj, D. W. Vaughn, S. A. Ogata, D. E. Clements, and P. Devine. 2001. Use of recombinant envelope proteins for serological diagnosis of dengue virus infection in an immunochromatographic assay. Clin. Diagn. Lab. Immunol. 8:1150-1155.[Abstract/Free Full Text]
  3. Dos Santos, F. B., M. P. Miagostovich, R. M. Nogueira, H. G. Schatzmayr, L. W. Riley, and E. Harris. 2004. Analysis of recombinant dengue virus polypeptides for dengue diagnosis and evaluation of the humoral immune response. Am. J. Trop. Med. Hyg. 71:144-152.[Abstract/Free Full Text]
  4. Garcia, G., D. W. Vaughn, and R. M. Del Angel. 1997. Recognition of synthetic oligopeptides from nonstructural proteins NS1 and NS3 of dengue-4 virus by sera from dengue virus-infected children. Am. J. Trop. Med. Hyg. 56:466-470.
  5. Gibbons, R. V., and D. W. Vaughn. 2002. Dengue: an escalating problem. BMJ 324:1563-1566.[Free Full Text]
  6. Harris, E., E. Videa, L. Perez, E. Sandoval, Y. Tellez, M. L. Perez, R. Cuadra, J. Rocha, W. Idiaquez, R. E. Alonso, M. A. Delgado, L. A. Campo, F. Acevedo, A. Gonzalez, J. J. Amador, and A. Balmaseda. 2000. Clinical, epidemiologic, and virologic features of dengue in the 1998 epidemic in Nicaragua. Am. J. Trop. Med. Hyg. 63:5-11.[Abstract]
  7. Huang, J. L., J. H. Huang, R. H. Shyu, C. W. Teng, Y. L. Lin, M. D. Kuo, C. W. Yao, and M. F. Shaio. 2001. High-level expression of recombinant dengue viral NS-1 protein and its potential use as a diagnostic antigen. J. Med. Virol. 65:553-560.[CrossRef][Medline]
  8. Lindenbach, B. D., and C. M. Rice. 2001. Flaviviridae: the viruses and their replication, p. 991-1041. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed. Lippincott Williams and Wilkins, Philadelphia, Pa.
  9. Ludolfs, D., S. Schilling, J. Altenschimidt, and H. Schmitz. 2002. Serological differentiation of infections with dengue virus serotypes 1 to 4 by using recombinant antigens. J. Clin. Microbiol. 40:4317-4320.[Abstract/Free Full Text]
  10. Mandl, C. W., F. Guirakhoo, H. Holzman, F. X. Heinz, and C. Kunz. 1989. Antigenic structure of the flavivirus envelope protein E at the molecular level, using tick-born encephalitis virus as a model. J. Virol. 63:564-571.[Abstract/Free Full Text]
  11. Simmons, M., K. R. Porter, J. Escamilla, R. Graham, D. M. Watts, K. H. Eckels, and C. G. Hayes. 1998. Evaluation of recombinant dengue viral envelope B domain protein antigens for the detection of dengue complex-specific antibodies. Am. J. Trop. Med. Hyg. 58:144-151.[Abstract]
  12. Staropoli, I., M. P. Frenkiel, F. Megret, and V. Deubel. 1997. Affinity-purified dengue-2 virus envelope glycoprotein induces neutralizing antibodies and protective immunity in mice. Vaccine 15:1946-1954.[CrossRef][Medline]
  13. Vorndam, V., and G. Kuno. 1997. Laboratory diagnosis of dengue virus infections, p. 313-333. In D. J. Gubler and G. Kuno (ed.), Dengue and dengue hemorrhagic fever. CAB International, New York, N.Y.
  14. Wu, H. C., Y. L. Huang, T. T. Chao, J. T. Jan, J. L. Huang, H. Y. Chiang, C. C. King, and M. F. Shaio. 2001. Identification of B-cell epitope of dengue virus type 1 and its application in diagnosis of patients. J. Clin. Microbiol. 39:977-982.[Abstract/Free Full Text]

Clinical and Diagnostic Laboratory Immunology, July 2005, p. 882-884, Vol. 12, No. 7
1071-412X/05/$08.00+0     doi:10.1128/CDLI.12.7.882-884.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Videa, E.
Right arrow Articles by Harris, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Videa, E.
Right arrow Articles by Harris, E.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev. Infect. Immun.
J. Clin. Microbiol. J. Virol. ALL ASM JOURNALS