CVI
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abel, K.
Right arrow Articles by Miller, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abel, K.
Right arrow Articles by Miller, C. J.

 Previous Article  |  Next Article 

Clinical and Diagnostic Laboratory Immunology, May 2005, p. 606-621, Vol. 12, No. 5
1071-412X/05/$08.00+0     doi:10.1128/CDLI.12.5.606-621.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Deoxycytidyl-Deoxyguanosine Oligonucleotide Classes A, B, and C Induce Distinct Cytokine Gene Expression Patterns in Rhesus Monkey Peripheral Blood Mononuclear Cells and Distinct Alpha Interferon Responses in TLR9-Expressing Rhesus Monkey Plasmacytoid Dendritic Cells

Kristina Abel,1,2* Yichuan Wang,1,2 Linda Fritts,1,2 Eleonora Sanchez,1,2 Eugene Chung,4 Patricia Fitzgerald-Bocarsly,4 Arthur M. Krieg,5 and Christopher J. Miller1,2,3

Center for Comparative Medicine,1 California National Primate Research Center,2 Department of Pathology, Microbiology and Immunology, School of Veterinary Medicine, University of California—Davis, Davis, California,3 Department of Pathology and Laboratory Medicine, UMDNJ-New Jersey Medical School and Graduate School of Biomedical Sciences, Newark, New Jersey,4 Coley Pharmaceutical Group, Inc., Wellesley, Massachusetts5

Received 27 October 2004/ Returned for modification 7 January 2005/ Accepted 2 March 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine if deoxycytidyl-deoxyguanosine oligonucleotides (CpG ODN) can be used effectively as nonspecific inducers of innate immune defenses for preventative or therapeutic interventions in infectious disease models for nonhuman primates, the present study evaluated the response of rhesus monkey peripheral blood mononuclear cells to three different synthetic CpG ODN classes by defining the cytokine gene expression patterns and by characterizing IFN-{alpha}/ß responses. Depending on the type and dose of CpG ODN used for stimulation, distinct gene expression patterns were induced. CpG ODN class A (CpG-A ODN) and CpG-C ODN, but not CpG-B ODN, were potent inducers of alpha interferon (IFN-{alpha}), and this response was due to IFN-{alpha} production by TLR9-positive plasmacytoid dendritic cells. Importantly, there was a dose-dependent increase in IFN-{alpha} responses to CpG-A ODN but a dose-dependent decrease in IFN-{alpha} responses by CpG-B ODN. The most sustained IFN-{alpha} response was induced by CpG-A ODN and was associated with a stronger induction of interferon regulatory factor 7 and the induction of several interferon-stimulated genes. In contrast, and independent of the dose, CpG-B ODN were the weakest inducers of IFN-{alpha} but the most potent inducers of proinflammatory cytokines. CpG-C ODN induced cytokine gene expression patterns that were intermediate between those of CpG-A and CpG-B ODN. Thus, the different types of CpG ODN induce different post-TLR9 signaling pathways that result in distinct cytokine gene expression patterns. Based on these findings, A and C class CpG ODN, but not B class CpG ODN, may be particularly suited for use as therapeutic or prophylactic antiviral interventions.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In recent years, many nonhuman primate models of viral infections have been developed to study virus-host interactions and to test the efficacy of possible vaccine candidates (9, 42, 45, 53, 54). Importantly, monkey models of simian immunodeficiency virus (SIV) infection are the best animal models available to study human immunodeficiency virus (HIV) infection and AIDS pathogenesis (48, 49). As the AIDS pandemic continues at an uncontrolled rate, and as new infectious diseases emerge (20, 47), there is an urgent need to design strategies aimed at the prevention of viral transmission and control of early virus replication. Part of this effort is the development of immunomodulatory drugs that have the ability to stimulate innate antiviral immune responses that can block transmission or reduce early virus replication and thereby limit virus dissemination.

IFN-{alpha}/ß are critical cytokines in the initial phase of antiviral immune responses, as they serve two important functions: they exert direct innate antiviral effects via interferon-stimulated genes (ISG), and they promote adaptive cellular antiviral immune responses (6, 11, 12, 14, 18, 29, 32, 39, 40, 43, 51, 52, 57, 58). Thus, the manipulation of the interferon system by immunomodulatory compounds, such as deoxycytidyl-deoxyguanosine oligonucleotides (CpG ODN), has potential utility as a therapeutic intervention aimed at the prevention and control of viral infections (36).

There are three main classes of synthetic CpG ODN that differ in the type and magnitude of immune responses induced. CpG ODN of the A class (CpG-A ODN) are very strong inducers of alpha interferon (IFN-{alpha}) by plasmacytoid dendritic cells (PDC) and are especially potent NK cell activators (35, 55, 56). CpG-B ODN are weaker inducers of IFN-{alpha}, but are potent activators of B cells (25, 35). CpG-C ODN have the combined features of CpG-A and CpG-B ODN: they are strong inducers of PDC IFN-{alpha} production and strong B-cell activators (24, 44, 67). All classes of CpG ODN promote T helper 1 (Th1) responses to coadministered antigens through the induction of cytokines in activated dendritic cells.

Thus, due to the robust induction of IFN-{alpha}, CpG-A ODN are potential candidates for prophylactic inducers of innate immune defenses in the prevention of viral infections and other infectious diseases. However, CpG-A ODN are not currently being developed for clinical use, because their poly(G) motifs render them more difficult to produce than the other CpG ODN classes (24, 35). Few studies have yet investigated the immune properties of CpG-C ODN, but based on their known ability to induce strong IFN-{alpha} production in human cells (24, 44, 67), they could be used for therapeutic interventions in infectious disease settings.

Nonhuman primates can respond to the same CpG-A and CpG-B ODN that have strong immune activity in humans, and CpG-B ODN have been used successfully as vaccine adjuvants in several monkey studies (31, 62, 65, 66). However, there are no published reports that CpG ODN can be used effectively for preventative or therapeutic interventions in viral diseases in nonhuman primates or humans.

The goal of the present study was to compare the relative suitability of the three CpG ODN classes for in vivo virus studies by defining the gene expression pattern in rhesus monkey peripheral blood mononuclear cells (PBMC) to stimulation with the three CpG ODN classes. Further, we sought to characterize the basis for the very different IFN-{alpha}/ß responses they induce and to determine the nature of the IFN-{alpha}-producing cell types in CpG ODN-stimulated rhesus monkey PBMC. We found that the gene expression pattern induced in rhesus monkey PBMC is dependent on the type and dose of CpG ODN used for stimulation. Thus, CpG-A and CpG-C ODN, but not CpG-B ODN, were potent inducers of IFN-{alpha} responses, and this response was mediated predominantly by TLR9-expressing PDC. CpG-A ODN induced the most sustained IFN-{alpha} response, and this was associated with a stronger induction of the interferon regulatory factor 7 (IRF-7) and resulted in the strong and prolonged induction of several interferon-stimulated genes. The distinct cytokine expression patterns induced by the different CpG ODN classes suggest that each may have a unique clinical application.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PBMC isolation and in vitro PBMC cultures. PBMC collected from rhesus macaques (Macaca mulatta), housed at the California National Primate Research Center in accordance with Association for the Assessment and Accreditation of Laboratory Animal Care standards, were isolated from heparin blood using lymphocyte separation medium from ICN Biomedicals (Aurora, OH). PBMC were cultured in 24-well plates at 1 x 106 cells/ml in RPMI 1640 supplemented with 10% fetal bovine serum, penicillin-streptomycin and L-glutamine. CpG ODN were provided by Coley Pharmaceutical Group, Inc. (Wellesley, MA) and had undetectable endotoxin levels (<0.1 endotoxin unit/ml) as measured by a Limulus assay (BioWhittaker, Verviers, Belgium). The specific CpG ODN used were chosen as representative examples of each CpG ODN class based on their response in human PBMC (67). PBMC were stimulated with 5 or 50 µg of CpG ODN 2216 (A class), ODN 10106 (B class), or ODN 2395 (C class) per ml, and cultures were incubated for 6 h at 37°C and 5% CO2. The CpG ODN had the following sequences: CpG ODN 2216, GGGGGACGATCGTCGGGGGG; CpG ODN 10106, TCGTCGTTTTTCGTGCGTTTTT; CpG ODN 2395, TCGTCGTTTTCGGCGCGCGCCG. Control cultures consisted of PBMC cultured in medium only. To determine the kinetics of cytokine mRNA expression, PBMC were stimulated with 5 µg of each class of CpG ODN and cultured for 4 days at 37°C and 5% CO2 (cell viability was not significantly reduced during this culture period; data not shown). At 6, 12, 24, 48, and 96 h, cells and culture media were harvested. Cells were lysed in TRIzol for subsequent RNA isolation. Culture supernatants were analyzed for IFN-{alpha} and interferon-inducible protein 10 (IP-10/CXCL10) by enzyme-linked immunosorbent assay (ELISA).

ELISA. Samples of culture media were analyzed for IFN-{alpha} and IP-10/CXCL10 using commercially available ELISA kits from BioSource International (Camarillo, CA) and R&D Systems (Minneapolis, MN), respectively. All samples were tested in duplicate. It should be noted that the ELISA kit for IFN-{alpha} detects multiple IFN-{alpha} subtypes. Note that although it is stated by the manufacturer that the human IFN-{alpha} ELISA kit shows cross-reactivity with rhesus monkey IFN-{alpha}, the provided reference does not clearly demonstrate such reactivity.

Fluorescence-activated cell sorter (FACS) analysis of IFN-{alpha}-producing cells. PBMC cultures were set up as described above, and 1 x 106 PBMC were stimulated for 6 h with 5, 10, or 50 µg of CpG ODN. PBMC cultured in media alone served as negative control cultures. Positive control cultures were stimulated for 6 h with herpes simplex virus (HSV) at a multiplicity of infection (MOI) of 1 as described previously (15, 19, 30). During the last 2 h of stimulation, brefeldin A (10 µg/ml) was added to all cultures. In preliminary studies, brefeldin A was added for different lengths of time during the culture period, and it was determined that the addition of brefeldin A during the last 2 h of incubation allowed detection of the maximum number of IFN-{alpha}-positive cells (data not shown). Intracellular cytokine (ICC) staining with a monoclonal antibody for IFN-{alpha} (clone MMHA-2; PBL Biomedical Laboratories, Piscataway, NJ) was combined with surface marker staining to determine the phenotype of the IFN-{alpha}-producing cells. Cells were phenotyped using a FITC lineage marker antibody cocktail (340546, Lin 1; anti-CD3, anti-CD14, anti-CD16, anti-CD19, anti-CD20, and anti-CD56; Becton Dickinson), anti-HLA-DR-PerCP (clone L243; Becton Dickinson), and anti-CD123-PE (clone 7G3; BD Pharmingen). As the anti-CD3 antibody in the lineage cocktail does not cross-react with rhesus monkey cells, an additional anti-CD3-FITC antibody was included (clone SP34; BD Pharmingen). After cell surface marker staining, cells were fixed with 1% paraformaldehyde (Electron Microscopy Sciences, Washington, PA) in phosphate-buffered saline (Sigma, St. Louis, MO) and permeabilized using phosphate-buffered saline supplemented with 0.5% saponin (Sigma) and 2% fetal bovine serum and stained for intracellular IFN-{alpha} using an IFN-{alpha} antibody that recognizes multiple IFN-{alpha} subtypes. The IFN-{alpha} antibody was conjugated with allophycocyanin using a Zenon labeling kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. A total of 200,000 cells were collected and analyzed on a FACSCalibur (Becton Dickinson). The data were analyzed with FlowJo software (Tree Star Inc., Ashland, OR) using two different strategies. First, to determine the total frequencies and the identity of IFN-{alpha}-producing cells in PBMC, a forward and side scatter gate that included lymphocytes and large mononuclear cells was set. IFN-{alpha}-positive cells were then gated and analyzed for the percentage of PDC among IFN-{alpha}-secreting cells. PDC were defined as lineage marker-negative and CD123- and HLA-DR-positive cells. Second, to determine the proportion of PDC producing IFN-{alpha} in response to CpG ODN stimulation, PDC frequencies in the PBMC population were determined first, and the percentage of IFN-{alpha}-producing cells within the PDC population is reported.

TLR9 expression. Rhesus monkey PBMC or tissue cell suspensions were stained for surface antigens (CD3-PerCP, CD20-APC, and CD123-PE; BD Pharmingen) as described above to define rhesus monkey PBMC cell populations. After cell surface antigen staining, cells were fixed, permeabilized as described above, and stained for TLR9 with mouse anti-human TLR9 FITC-labeled antibody (Imgenex, San Diego, CA). The TLR9 antibody was tested over a wide range of concentrations (0.01 to 2 µg); the manufacturer's recommendation is 2 µg per 1 x 106 cells (Imgenex). For control purposes, rhesus monkey PBMC were stained with 2 µg of mouse-anti-human immunoglobulin G1 (IgG1) antibody (BD Pharmingen). A total of 1 x 106 cells were collected by using a FACSCalibur, and data were analyzed with FlowJo software (Tree Star, Inc.). TLR9 expression was determined for CD3-positive T cells, CD20 (clone 2H7; BD Pharmingen)-positive B cells, and CD3- and CD20-negative/CD123-positive PDC. The median fluorescence intensity (MFI) for each cell population is reported.

In addition, TLR9 mRNA levels were determined for distinct cell populations. Rhesus monkey lymph node cell suspensions were sorted for T cells, macrophages, and PDC. The following sorting strategy (data not shown) was applied using a MoFlo instrument (Dako, Carpenteria, CA). First, dead cells were excluded from the analysis by staining with propidium iodide (Sigma). Viable cells were then gated on CD20 and CD16 (clone 3G8; BD Pharmingen), and only cells negative for surface expression of CD20 and CD16 were included for collection. CD16/CD20 double-negative cells that were positive for CD3 were sorted into CD3/CD4 double-positive T cells and CD3-positive/CD4-negative T cell populations. CD16/CD20/CD3 triple-negative cells were then sorted into CD14-positive cells (macrophages) and CD123-positive cells (PDC). Sorted cell populations were immediately lysed in TRIzol and stored at –80°C until RNA isolation (see below). PCR amplification for TLR9 message was performed as described below.

Amplification of cytokines, interferon-regulatory factors, and interferon-stimulated genes by reverse transcriptase real-time PCR. Total RNA was isolated using TRIzol (Invitrogen, Grand Island, NY) according to the manufacturer's protocol. All samples were DNase treated with DNA-free (Ambion) for 1 h at 37°C. cDNA was prepared using random hexamer primers (Amersham-Pharmacia Biotech, Inc., Piscataway, NJ) and Moloney murine leukemia virus reverse transcriptase (Invitrogen). Real-time PCR was performed as previously described (1, 3, 4). Briefly, samples were tested in duplicate, and the PCR for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the target gene from each sample were run in parallel on the same plate. The reaction was carried out on a 96-well optical plate (Applied Biosystems, Foster City, CA) in a 25-µl reaction volume containing 5 µl cDNA and 20 µl Master Mix (Applied Biosystems). All sequences were amplified using the 7900 default amplification program, as follows: 2 min. at 50°C, 10 min. at 95°C, 40 cycles of 15 s at 95°C, and 1 min. at 60°C. Results were analyzed with the SDS 7900 system software, version 2.1 (Applied Biosystems). The mRNA expression levels were calculated from normalized change in cycle threshold ({Delta}Ct) values and are reported as the increase of target gene mRNA levels in CpG ODN- or HSV-stimulated PBMC of each individual monkey compared to target gene PBMC mRNA levels in medium control PBMC cultures of the same donor at the same time point. Ct values correspond to the cycle number at which the fluorescence due to enrichment of the PCR product reaches significant levels above the background fluorescence (threshold). In this analysis, the Ct value for the housekeeping gene (GAPDH) is subtracted from the Ct value of the target gene. The {Delta}Ct value for the CpG ODN- or HSV-stimulated PBMC sample is then subtracted from the {Delta}Ct value of the corresponding medium control sample of the same donor PBMC at the same time point ({Delta}{Delta}Ct). Assuming that the target gene and the reference gene (GAPDH) are amplified with the same efficiency (data not shown), the increase in target gene mRNA levels in CpG ODN- or HSV-stimulated PBMC compared to PBMC mRNA levels in medium control cultures (labeled as "Increase in mRNA levels" on the y axis of relevant figures) is then calculated as: increase = 2{Delta}{Delta}Ct (User bulletin 2, ABI Prism 7700 sequence detection system; Applied Biosystems).

Primer-probe sequences for IFN-ß, (2',5')-oligoadenylate synthetase (OAS), IP-10/CXCL10, tumor necrosis factor alpha (TNF-{alpha}), interleukin 6 (IL-6), the p40 subunit of IL-12 (IL-12p40), and IFN-{gamma} have been published previously (1-4). The primer-probe sequences for IFN-{alpha} were based on the human IFN-{alpha} 2 gene, GenBank accession number Y11834 (2). The following sequences (5'-to-3' direction) were used to amplify IRF-3, 5, and 7: for IRF-3, forward primer AAG CCA GAC CTG CCA ACC T, reverse primer CTT GCT CCG GTC CTC TGC TA, and probe CCT CAA CCG CAA AGA AGG GTT GCG; for IRF-5, forward primer TTC GAG ATC TTC TTC TGC TTT GG, reverse primer GCT ACA GGC ACC ACC TGT ACA G, and probe CGC AAA CCC CGA GAG AAG AAG CTC A; for IRF-7, forward primer TCC CCA CGC TAT ACC ATC TAC CT, reverse primer ACA GCC AGG GTT CCA GCT T, and probe ACC AGG ACC AGG CTC TTC TCC TTG GG. Note that the probes were 3' labeled with 6-carboxyfluorescein and 5' labeled with 6-carboxytetramethylrhodamine.

TLR9 mRNA was amplified using the following primer-probe pair (5'-to-3' direction) that was designed based on the human TLR9 sequence (GenBank accession number AF245704.1): forward primer, CTC TGA AGA CTT CAG GCC CAA CT; reverse primer, TGC ACG GTC ACC AGG TTG T; and probe, AGC ACC CTC AAC TTC ACC TTG GAT CTG TC. TLR9 mRNA expression levels in various rhesus monkey cell populations are reported as relative increase in TLR9 mRNA levels compared to TLR9 mRNA levels in CD3+CD4+ T cells.

Statistical analysis. Data were, if not otherwise indicated, analyzed by One-Way ANOVA with post hoc Tukey comparisons using InStat software (Graph Pad Software Inc., San Diego, CA). Area-under-the-curve analysis and correlations between multiple data sets were determined using Prism software, version 4.0 (Graph Pad Software Inc.).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{alpha}/ß mRNA and protein expression levels in rhesus monkey PBMC after CpG ODN stimulation. CpG ODN of all three classes induced a rapid increase of IFN-{alpha} mRNA levels, but there were clear differences in the kinetics and duration of the response depending on the type and dose of CpG ODN used.

Independent of the type of CpG ODN used, IFN-{alpha} mRNA levels were increased several hundred- to several thousand-fold by 6 h (Fig. 1). Importantly, however, IFN-{alpha} mRNA levels increased significantly in a dose-dependent manner after stimulation with CpG-A ODN (P = 0.01), whereas in CpG-B ODN-stimulated PBMC, there was a statistically significant dose-dependent decrease in IFN-{alpha} mRNA levels (P = 0.003) (Fig. 1). Similarly, there was a trend toward reduced IFN-{alpha} mRNA levels in 50 µg compared to 5 µg CpG-C ODN-stimulated PBMC, but this difference did not reach the level of statistical significance (Fig. 1).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Dose-dependent changes in IFN-{alpha} mRNA levels for CpG ODN-stimulated rhesus monkey PBMC. The average increases (± standard errors of the means [SEM]) in IFN-{alpha} mRNA levels for three donors at 6 h after stimulation with 5 or 50 µg CpG-A (black bars), CpG-B (open bars), and CpG-C ODN (striped bars) are shown relative to IFN-{alpha} mRNA levels in medium-only control cultures of the same PBMC. Statistically significant, dose-dependent changes in IFN-{alpha} mRNA levels for a specific type of CpG ODN are indicated by P values below the x axis. Statistically significant differences in IFN-{alpha} mRNA levels dependent on the type of CpG ODN used after stimulation with 50 µg CpG ODN are indicated by P values above the bars.

 
As all three classes of CpG ODN induced a marked increase in IFN-{alpha} mRNA levels after 6 h of stimulation with 5 µg of CpG ODN, this concentration was chosen to determine the kinetics and duration of the IFN-{alpha}/ß response in subsequent experiments. In CpG-A ODN-stimulated PBMC, IFN-{alpha} mRNA levels peaked between 12 and 24 h, persisted at increased levels for 48 h, and were undistinguishable from baseline IFN-{alpha} mRNA levels by 96 h (Fig. 2A). In contrast, IFN-{alpha} mRNA levels in cultures stimulated with CpG-B ODN were highest at 6 h, were declining by 12 h, and were undistinguishable from baseline IFN-{alpha} mRNA levels by 24 h. Stimulation with the CpG-C ODN showed a pattern that was intermediate between those of CpG-A and CpG-B ODN. Importantly, despite a relatively large donor-to-donor variation in the response to CpG ODN, the observed differences in the IFN-{alpha} response depending on the type of CpG ODN used reached statistical significance. At 24 and 48 h, IFN-{alpha} mRNA levels were significantly higher (P < 0.001 and P < 0.01, respectively) in CpG-A ODN compared to both CpG-B and CpG-C ODN-stimulated PBMC. Further, area-under-the-curve analysis of IFN-{alpha} mRNA levels over the 96-h culture period (data not shown) showed that IFN-{alpha} mRNA levels were significantly higher in CpG-A ODN than in CpG-B and CpG-C ODN-stimulated PBMC (P < 0.05). Consistent with the intermediate response pattern observed for CpG-C ODN-stimulated PBMC, IFN-{alpha} mRNA levels at the 24-h time point were significantly higher (P < 0.05) in CpG-C ODN than in CpG-B ODN-stimulated PBMC (Fig. 2A). Thus, the kinetics and duration of IFN-{alpha} mRNA expression differed depending on the type of CpG ODN used.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 2. IFN-{alpha}/ß mRNA levels in CpG ODN-stimulated rhesus monkey PBMC. The average increase (±SEM) in IFN-{alpha} and IFN-ß mRNA levels of 10 donors at various time points after CpG ODN stimulation (5 µg) is shown relative to IFN-{alpha} and IFN-ß mRNA levels in medium-only control cultures of the same PBMC. (A) Increase in IFN-{alpha} mRNA levels. The inset shows the kinetics of IFN-{alpha} mRNA induction in rhesus monkey PBMC in the first 12 h after CpG-B ODN stimulation. Average mRNA levels for three different donors are shown. (B) Increase in IFN-ß mRNA levels. The inset shows the kinetics of IFN-ß mRNA induction in rhesus monkey PBMC in the first 12 h after CpG-B ODN stimulation. Average mRNA levels for three different donors are shown. IFN-{alpha}/ß mRNA levels in class A, B, and C CpG ODN-stimulated PBMC are represented by open triangles, open circles, and open diamonds, respectively. The asterisks denote statistically significant differences (P < 0.05) between groups.

 
The induction of IFN-{alpha} is preceded by the induction of IFN-ß (52, 57). In fact, for all three CpG ODN classes, increases in IFN-ß mRNA levels were observed, but they were transient in nature and less sustained than the IFN-{alpha} response (Fig. 2B). IFN-ß mRNA levels increased during the first 12 h after CpG-A and CpG-C ODN stimulation and then returned to baseline levels by 24 h (Fig. 2B). In contrast, after CpG-B ODN stimulation, IFN-ß mRNA levels rapidly declined after 6 h and, thus, it is likely that the peak of IFN-ß mRNA expression occurred prior to 6 h. This was consistent with the more rapid and transient induction of IFN-{alpha} mRNA levels after CpG-B ODN stimulation. Thus, to more accurately determine the kinetics and peak responses of IFN-ß and IFN-{alpha} mRNA induction after CpG-B ODN stimulation, IFN-ß and IFN-{alpha} mRNA levels were measured at 2, 4, 6, and 12 h in a subset of donors (Fig. 2, insets). Indeed, peak IFN-{alpha} mRNA levels were reached at 4 h (Fig. 2A, inset), and IFN-ß mRNA levels were only transiently increased between 2 and 6 h after CpG-B ODN stimulation (Fig. 2B, inset).

The results of the PCR-based analysis of PBMC IFN-{alpha} mRNA levels after CpG ODN stimulation were compared to IFN-{alpha} protein production by performing an ELISA measuring multiple IFN-{alpha} subtypes in supernatants collected from cultures stimulated with 5 µg of CpG ODN. This concentration was chosen as it resulted in similar peak IFN-{alpha} mRNA levels independent of the type of CpG ODN used. As expected, the increase in IFN-{alpha} mRNA levels preceded the peak increase in IFN-{alpha} protein at 24 and 48 h (Fig. 3). Although relatively low levels of IFN-{alpha} protein were detectable in rhesus monkey PBMC cultures compared to results obtained in similar studies using human PBMC cultures (67), it should be noted that an ELISA specific for human IFN-{alpha} was used for these monkey experiments, and the extent to which this human IFN-{alpha} ELISA cross-reacts with rhesus monkey IFN-{alpha} is unknown (see Materials and Methods). Despite the possibility that the ELISA may not have detected all of the protein in the culture media, IFN-{alpha} protein levels were significantly higher in CpG-A ODN-stimulated PBMC than in CpG-B and CpG-C ODN at 24 and 48 h (P < 0.02 and P < 0.006, respectively, Mann-Whitney test). Although peak IFN-{alpha} mRNA levels were similar in all three classes of CpG ODN, IFN-{alpha} protein levels in CpG-B ODN-stimulated PBMC never reached the levels found for CpG-A and CpG-C ODN-stimulated PBMC. The most likely explanation for this result is that the transient increase in IFN-{alpha} mRNA in CpG-B ODN-stimulated PBMC was not of sufficient duration to stimulate equivalent protein production (Fig. 3).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. IFN-{alpha} protein levels in supernatants of PBMC stimulated by CpG-A, CpG-B, and CpG-C ODN (5 µg) as measured by ELISA. Average IFN-{alpha} protein levels for the same donors as in Fig. 2 are shown. Medium, medium-only control cultures.

 
Frequency and phenotype of IFN-{alpha}-producing cells. The frequency and phenotype of IFN-{alpha}-producing cells in CpG ODN-stimulated rhesus monkey PBMC was determined using a flow cytometry-based ICC assay. In medium control cultures, frequencies of IFN-{alpha}-positive cells were low (0.002 to 0.009%) (Table 1). As a positive control, PBMC cultures of the same donors were infected with HSV, a virus known to induce IFN-{alpha} production in human and rhesus monkey PBMC (15, 19, 30). As expected, IFN-{alpha}-secreting cells (0.06 to 0.41% of PBMC) were readily detectable in HSV-stimulated rhesus monkey PBMC (Fig. 4; Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Frequencies of IFN-{alpha} positive PBMC and IFN-{alpha} positive PDCa

 


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 4. Frequency of IFN-{alpha}-positive cells after 6 h of stimulation with different concentrations of the CpG ODN. The top row shows the gating strategy based on a forward and side scatter gate that included lymphocytes, monocytes, and dendritic cells (left panel) and the frequency of IFN-{alpha}-positive cells in medium-only negative control cultures (middle panel) and in HSV-stimulated positive control cultures (right panel). Note that frequencies of IFN-{alpha}-positive cells in medium-only control cultures never exceed 0.009% of PBMC. HSV-stimulated PBMC served as positive controls. The relative frequencies of IFN-{alpha}-positive cells after stimulation of rhesus monkey PBMC with various doses of CpG-A (second row), CpG-B (third row), and CpG-C ODN (fourth row) as determined by FACS analysis are shown. Data for one out of three representative donors are shown. APC, allophycocyanin.

 
The ability to detect IFN-{alpha}-secreting cells by ICC after 6 h of CpG ODN stimulation was associated with the kinetics and magnitude of IFN-{alpha} mRNA induction. Consistent with the more rapid induction of IFN-{alpha} mRNA in CpG-B ODN-stimulated PBMC and the assumption that a threshold amount of IFN-{alpha} protein needs to accumulate within responding cells to allow the detection of IFN-{alpha}-producing cells in the whole PBMC population by FACS analysis, at 6 h after stimulation with 5 µg of all three CpG ODN classes, IFN-{alpha}-producing cells were consistently detectable only after CpG-B ODN stimulation (0.021% to 0.054% of PBMC) (Fig. 4; Table 1). In CpG-A ODN-stimulated PBMC, in which IFN-{alpha} mRNA levels peaked between 12 and 24 h, IFN-{alpha}-producing cells were detectable for only one out of three donors (28893) after 6 h of stimulation with 5 µg CpG-A ODN (0.021% of PBMC) (Fig. 4, Table 1). However, consistent with the dose-dependent increase in IFN-{alpha} mRNA levels by CpG-A ODN, IFN-{alpha}-secreting cells were readily detectable for all three donors after stimulation with 50 µg of CpG-A ODN. Stimulation of rhesus monkey PBMC with CpG-C ODN resulted in an intermediate dose response pattern compared to CpG-A and CpG-B ODN (Fig. 4; Table 1). IFN-{alpha}-producing cells were detectable after stimulation with 5 µg CpG-C ODN for only one out three donors tested and for two out of three donors after stimulation with 10 µg CpG-C ODN, while IFN-{alpha}-producing cells were detectable for five out of six donors when stimulated with 50 µg CpG-C ODN (Fig. 4; Table 1). In contrast, and consistent with the dose-dependent decrease of IFN-{alpha} mRNA levels after CpG-B ODN stimulation, the frequencies of IFN-{alpha} producing in PBMC stimulated with 50 µg of CpG-B ODN were undistinguishable from medium control cultures (Fig. 4; Table 1).

Thus, while there were no apparent differences in the peak frequencies of IFN-{alpha}-producing cells depending on the type of CpG ODN used, the dose of each type of CpG ODN required to detect this response in a 6-h ICC assay differed. It is noteworthy that the frequencies of IFN-{alpha}-producing cells in CpG ODN-stimulated PBMC never reached the frequencies seen with paired HSV-stimulated cultures (average, 0.18% of PBMC; range, 0.06 to 0.41%) (Table 1).

The discrepancy between the marked increase in IFN-{alpha} mRNA levels and low frequencies of IFN-{alpha}-secreting cells in CpG ODN-stimulated rhesus monkey PBMC is consistent with the conclusion that a relatively rare cell population accounts for the bulk of the IFN-{alpha} mRNA and protein production. It has been demonstrated that CpG ODN-dependent IFN-{alpha} production requires signaling through TLR9 (27). Therefore, rhesus monkey PBMC and tissue cell suspensions were stained with a human anti-TLR9 antibody, and TLR9 expression was determined for T cells, B cells, and PDC (Fig. 5). All three cell populations showed intracellular expression of TLR9 compared to the isotype control antibody (Fig. 5B). It should be noted that the TLR9 antibody was tested at multiple concentrations, ranging from 0.01 to 2 µg per one million cells, and the same general pattern was observed at all concentrations tested (data not shown). A representative example of intracellular TLR9 expression in rhesus monkey tissue cell suspensions using a low TLR9 antibody concentration (0.05 µg) is shown in Fig. 5A. A similar expression pattern was observed at higher TLR9 antibody concentrations, and a representative histogram plot of TLR9 expression after staining with 2.0 µg of TLR9 antibody is shown in Fig. 5B for CD3+ T cells, CD20+ B cells, and CD3CD20CD123+ PDC of rhesus monkey blood. Importantly, in all samples tested (for PBMC, n = 4; for tissue cell suspensions, n = 4), the MFI was higher in PDC than in B cells and T cells. In contrast, even at the highest concentration tested, the MFI in all three cell populations stained with the relevant control IgG1 antibody was similar and much lower (Fig. 5B).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. Intracellular TLR9 staining in rhesus monkey cells. (A) The histograms indicate the levels of TLR9 staining in CD3+ T cells, CD20+ B cells and CD3CD20CD123+ PDC from a rhesus monkey spleen cell suspensions using TLR9 antibody at a concentration of 0.05 µg per 1 x 106 cells. The gating hierarchy is indicated by arrows. In each histogram, the percentage of TLR9-positive cells in each cell population based on the cutoff established by gating on the cells with the highest TLR9 staining shown in the top panel is shown. (B) Graphic overlays of mouse IgG1 control antibody histograms and TLR9 histograms are shown for CD3+ T cells (green lines), CD20+ B cells (blue lines) and CD3CD20CD123+ PDC (red lines) of rhesus monkey PBMC. Antibodies were used at 2 µg per 1 x 106 cells. Values for TLR9 staining indicate the MFI for each cell population.

 
In addition, we determined TLR9 mRNA levels in available FACS-sorted rhesus monkey T cells and PDC of peripheral and genital rhesus monkey lymph nodes (Table 2). TLR9 mRNA levels were 100- to 1,000-fold higher in rhesus monkey PDC than in T cells. Thus, the data suggest that, similar to humans, rhesus monkey PDC are the main TLR9-expressing cell population in rhesus monkeys and, thus, PDC are most likely the primary responder cell population to CpG ODN stimulation.


View this table:
[in this window]
[in a new window]
 
TABLE 2. TLR9 mRNA levels in rhesus cell populationsa

 
Indeed, after maximum stimulation with CpG-A ODN (50 µg), in three out of three donors tested, 78.0 to 87.8% of the IFN-{alpha}-producing cells were lineage marker-negative and CD123-positive cells and thus could be characterized as PDC (15, 16): (Fig. 6, Table 1). In two out of three donors stimulated with an optimal dose of CpG-B ODN (5 µg), 83.2 to 87.0% of the IFN-{alpha}-producing cells were PDC, but in one out of three donors, PDC accounted for only 23.7% of the IFN-{alpha}-producing cells. In rhesus monkey PBMC stimulated with 50 µg CpG-C ODN, PDC accounted for >50% of the IFN-{alpha}-producing cells in five out of six donors, but in one out of six donors, only 19.9% of the IFN-{alpha}-producing cells were PDC. Similarly, in rhesus monkey PBMC stimulated with 5 and 10 µg CpG-C ODN, >50% of the IFN-{alpha}-producing cells were PDC in two out of three donors, but in one out of three donors, <50% of the IFN-{alpha}-producing cells were PDC. The majority of the IFN-{alpha}-positive PDC after stimulation with the optimal dose of each CpG ODN class (CpG-A ODN, 50 µg; CpG-B ODN, 5 µg; and CpG-C ODN, 50 µg) expressed HLA-DR (54 to 100%) (Fig. 6, Table 1). Thus, despite the large variability observed in the frequencies of IFN-{alpha}-producing cells in response to CpG ODN, PDC are the main IFN-{alpha}-producing cell type in rhesus monkey PBMC after CpG ODN stimulation. The frequencies of IFN-{alpha}-producing cells and IFN-{alpha}-positive PDC for each individual donor tested in response to the various classes of CpG ODN and to the different doses of each CpG ODN are listed in Table 1.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 6. The phenotype of IFN-{alpha}-producing cells after CpG ODN stimulation. Representative examples of IFN-{alpha}-producing cell frequencies at 6 h after stimulation with CpG-A, CpG-B, or CpG-C ODN. Data for one out of three representative donors after CpG-A, CpG-B, CpG-C ODN, and HSV stimulation are shown. The phenotype was determined by gating on IFN-{alpha}-positive cells (see Fig. 4) and then gating on Lin-CD123+ (x axis) and CD123+ (y axis) cells. The Lin-CD123+ cells were then gated for analysis of HLA-DR expression. (Note that medium control cultures are not included in this figure, as frequencies of IFN-{alpha}-secreting cells did not exceed 0.009% of PBMC).

 
As detailed above, the frequencies of IFN-{alpha}-positive cells elicited in response to the same stimulus varied among the PBMC from different donors. Thus, the total frequency of PDC (LinCD123+HLA-DR+) in PBMC and the percentage of PDC responding with IFN-{alpha} production to each stimulus were determined for each donor (Table 1). Although the stronger IFN-{alpha} response to CpG-A ODN stimulation in monkey 28893 could not be explained by higher PDC frequencies in PBMC (0.049% of PBMC) compared to the other two donors (27593, 0.07%; 27962, 0.10% of PBMC), it is noteworthy that the one donor with the lowest frequency of IFN-{alpha}-producing cells after stimulation with 5 µg CpG-B ODN (26412) also had the lowest frequency of PDC among the three donors stimulated with 5 µg CpG-B ODN. In fact, there was a significant (P < 0.03) correlation between the frequencies of IFN-{alpha}-producing PBMC in response to optimal stimulation with each CpG ODN class and the frequencies of PDC in the PBMC population of the same donors (Table 1, values shown in boldface type). This observation is consistent with the conclusion that the PDC is the primary cell type responsible for IFN-{alpha} production in rhesus monkey PBMC.

Despite the fact that PDC accounted for the majority of the IFN-{alpha}-producing cells after CpG-A, CpG-B, and CpG-C ODN stimulation, only 5.6 to 52.5% of all PDC secreted IFN-{alpha} in response to CpG-A, CpG-B, and CpG-C ODN stimulation at the optimal dose (Table 1). In contrast, 45.7 to 79.8% of PDC produced IFN-{alpha} in response to HSV stimulation (Table 1).

IRFs and ISG. To determine why IFN-{alpha} mRNA levels were more sustained after A and C class compared to B class CpG ODN stimulation, gene expression levels for IRF-3, IRF-5, and IRF-7 were assessed after stimulation of rhesus monkey PBMC with 5 µg of CpG ODN. IRF-3 expression alone is sufficient for IFN-ß induction, but for IFN-{alpha} gene expression, IRF-5 and IRF-7 must be induced (8, 68). After CpG ODN stimulation, gene expression levels for IRF-3 in PBMC remained unchanged (data not shown), and IRF-5 mRNA levels increased only minimally and transiently at 12 h poststimulation with all three CpG ODN classes (data not shown). In contrast, IRF-7 mRNA levels increased, peaked at 24 h, and persisted at slightly elevated IRF-7 mRNA levels throughout the culture period (Fig. 7A). CpG-A ODN induced the most pronounced change in IRF-7 mRNA levels. However, due to variability in the response among donor animals and the small number of donors tested, the difference in IRF-5 and IRF-7 mRNA levels between CpG-A ODN and CpG-B or CpG-C ODN-stimulated rhesus monkey PBMC did not reach statistical significance.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 7. Gene expression levels for IRF-7 and ISG. (A) Average IRF-7 mRNA levels (± SEM) for eight donors are shown in response to 5 µg CpG ODN stimulation. (B and C) Average mRNA levels (± SEM) for OAS and IP-10/CXCL10, respectively, are shown. Increases in mRNA levels are relative to medium control cultures. (D) IP-10/CXCL10 protein levels as measured by ELISA of the supernatants of the same cultures used for gene expression analysis. Medium, medium-only control cultures.

 
The differences in mRNA levels of ISG induced in response to the three CpG ODN classes were striking. In general, the mRNA expression kinetics for OAS and IP-10/CXCL10 were similar to the kinetics of IRF-7 mRNA levels. mRNA expression levels peaked at 24 h, and elevated mRNA levels persisted throughout the culture period (Fig. 7B and C). The fastest and strongest increases in OAS and IP-10/CXCL10 mRNA levels were seen with CpG-A ODN-stimulated PBMC (Fig. 7B and C). In response to CpG-C ODN, OAS and IP-10/CXCL10 mRNA levels also increased rapidly, but by 24 h OAS and IP-10/CXCL10 mRNA levels had declined, whereas they persisted at peak levels in CpG-A ODN-stimulated PBMC. OAS and IP-10/CXCL10 mRNA levels were only slightly elevated in CpG-B ODN-stimulated PBMC. Thus, as was observed for IFN-{alpha} mRNA levels, CpG-A ODN-activated PBMC had significantly higher OAS and IP-10/CXCL10 mRNA levels than CpG-B ODN-stimulated PBMC (P < 0.05) at 24 and 48 h. Further, CpG-A ODN-induced OAS mRNA levels were significantly higher than those for CpG-C ODN (P < 0.05, Student's t test) at 48 h. In contrast, IP-10/CXCL10 mRNA levels had declined to similar levels in response to all three CpG ODN by 48 h. Consistent with IP-10/CXCL10 mRNA levels, IP-10/CXCL10 protein levels were significantly higher in culture supernatants of CpG-A ODN than in CpG-B ODN-stimulated PBMC at 24 h (P < 0.03, Student's t test), but levels were similar in all CpG ODN-stimulated cultures by 48 h (Fig. 7D). It should be noted that IP-10/CXCL10 could also be induced by IFN-{gamma}. Thus, although IFN-{alpha} induction is not sustained in CpG-B ODN-stimulated rhesus monkey PBMC, the induction of IFN-{gamma} by CpG-B ODN might be responsible for elevated IP-10/CXCL10 levels in CpG-B ODN-stimulated rhesus monkey PBMC at this later time point (see below).

Induction of proinflammatory cytokines by CpG ODN. Stimulation of rhesus monkey PBMC with class A, B, and C CpG ODN resulted in the induction of several proinflammatory cytokines, but the specific cytokines induced were dependent on the CpG ODN class used. In analogy to the comparative analysis of IFN-{alpha} and ISG mRNA levels after stimulation of rhesus monkey PBMC with the three different CpG ODN classes, the kinetics and duration of the induction of proinflammatory cytokines were determined using 5 µg of CpG ODN. Proinflammatory cytokines were most strongly induced by CpG-B ODN, were induced to a lesser extent by CpG-C ODN, and were induced least by CpG-A ODN (Fig. 8).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8. Gene expression levels of proinflammatory cytokines after stimulation of rhesus monkey PBMC with 5 µg of CpG ODN. (A) TNF-{alpha} mRNA levels. (B) IL-12p40 mRNA levels. (C) IL-6 mRNA levels. (D) IFN-{gamma} mRNA levels. The average increase in mRNA levels (± SEM) for 10 donors are shown compared to mRNA levels for medium-only control cultures.

 
The induction of TNF-{alpha} was rapid and transient, as TNF-{alpha} mRNA levels were highest at 6 h and had returned to baseline values by 24 h (Fig. 8A). Thus, and as observed for IFN-{alpha} mRNA levels, it is likely that the peak of TNF-{alpha} mRNA expression occurred prior to the 6-h collection. The difference in TNF-{alpha} mRNA levels in CpG-B ODN- and CpG-A ODN-stimulated PBMC at 6 h was statistically significant (P < 0.01) (Fig. 8A). CpG-B and CpG-C ODN also induced a transient increase in IL-12p40 mRNA levels, with the highest IL-12p40 mRNA levels being observed for CpG-B ODN-stimulated cultures (Fig. 8B). At both 6 and 12 h, IL-12p40 mRNA levels were significantly higher in CpG-B ODN- than in CpG-A ODN-stimulated PBMC (P < 0.05). IL-6 mRNA levels were persistently increased throughout the culture period after stimulation with CpG ODN of all three classes, but, as was observed for TNF-{alpha} and IL-12p40, IL-6 mRNA levels were highest after stimulation with CpG-B ODN and lowest with CpG-A ODN (Fig. 8C). In fact, IL-6 mRNA levels were significantly higher in CpG-B ODN- than in CpG-A ODN-stimulated PBMC at 24 and 48 h (P < 0.01 and P < 0.04, respectively, Student's t test) (Fig. 8C).

PBMC stimulation with 5 µg of CpG-B ODN also markedly elevated IFN-{gamma} mRNA levels, while only a slight and transient increase in IFN-{gamma} mRNA levels was induced by CpG-C ODN, and no IFN-{gamma} mRNA was induced by CpG-A ODN (Fig. 8D). Interestingly, however, an increase in IFN-{gamma} mRNA levels was observed with PBMC stimulated with 50 µg of CpG-A ODN (P < 0.02), while no further increase in IFN-{gamma} mRNA levels was observed with PBMC after stimulation with 50 µg of CpG-B or CpG-C ODN (Fig. 9D).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 9. Dose-dependent changes in mRNA levels of proinflammatory cytokines. The average increases (± SEM) in proinflammatory mRNA levels for three donors at 6 h after stimulation with 5 or 50 µg CpG-A, CpG-B, and CpG-C ODN are shown relative to the same cytokine mRNA levels in medium-only control cultures of the same PBMC. (A) TNF-{alpha} mRNA levels. (B) IL-12p40 mRNA levels. (C) IL-6 mRNA levels. (D) IFN-{gamma} mRNA levels.

 
Stimulation of rhesus monkey PBMC for 6 h with 50 µg of CpG-B ODN did not result in decreased mRNA levels of TNF-{alpha} and IL-6 and resulted in only slightly reduced mRNA levels of IL-12 (Fig. 9A to C). Thus, in contrast to the observed decrease in IFN-{alpha} mRNA levels after high-dose (50 µg) CpG-B ODN stimulation, CpG-B ODN had the most pronounced increase in proinflammatory cytokine mRNA levels of all three CpG ODN classes, and this was independent of the dose of CpG-B ODN used (Fig. 9).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In mouse model systems, CpG ODN have been used as vaccine adjuvants and to prevent bacterial, viral, and parasitic infections (21, 23, 34, 46, 70). CpG ODN are also effective as vaccine adjuvants in nonhuman primates and humans (17, 22, 31, 34, 62, 66). However, there are no published reports that CpG ODN can be used effectively for preventative or therapeutic interventions in viral diseases in nonhuman primates or humans. In the latter application, the induction of strong IFN-{alpha} responses is likely to be critical. To determine the relative suitability of the three different CpG ODN classes for use in the immunoprophylaxis of viral diseases, the present study analyzed the cytokine gene expression profiles induced in rhesus monkey PBMC by the three CpG ODN classes. Further, we determined the kinetics, duration, and dose dependency of the IFN-{alpha} response for each class of CpG ODN.

All three classes of CpG ODN induced an early IFN-{alpha} response in rhesus monkey PBMC characterized by a transient increase in IFN-ß mRNA levels followed by a rapid and more sustained induction of IFN-{alpha}. However, there were clear differences in the nature of the IFN-{alpha} response induced, depending on the type and dose of CpG ODN used. Although the induction of IFN-{alpha}/ß interferon mRNA levels in rhesus monkey PBMC was most rapid after CpG-B ODN stimulation, it was only transient. Consistent with previous reports (63, 64), IFN-{alpha} responses were more sustained in CpG-A ODN- than in CpG-B ODN-stimulated PBMC. We now show for the first time that rhesus monkey PBMC respond to CpG-C ODN with IFN-{alpha} responses that were intermediate in duration and magnitude compared to CpG-A- and CpG-B ODN-induced interferon responses. Importantly, the observed CpG ODN class-dependent differences in IFN-{alpha}/ß responses were statistically significant despite the variability of the responses among different donor PBMC. Class C CpG ODN also elicit responses intermediate between those of class A and B CpG ODN in human PBMC (67).

It has been previously demonstrated that PDC are the main IFN-{alpha}-producing cells after CpG ODN stimulation in humans (55), and we now report that rhesus monkey PDC are the main responder cell population to CpG ODN stimulation in rhesus monkey blood. Importantly, we demonstrate for the first time that rhesus monkey PDC express TLR9, the receptor for CpG ODN (10, 27). Further, and similar to data for humans (28, 69), TLR9 expression levels are higher in rhesus monkey PDC than in T and B cells. The observed frequencies of IFN-{alpha}-producing PDC in rhesus monkey PBMC were comparable to frequencies observed for human PBMC after CpG ODN stimulation (37). Consistent with studies of human PBMC that show that human B and T cells are not or are only weakly activated by CpG-A ODN (5, 24, 65), we detected very little IFN-{alpha} production in CD3+ T cells and CD20+ B cells in CpG ODN-stimulated rhesus monkey PBMC (data not shown). As PDC rapidly down-regulate CD123 upon activation (55), it is possible that, in fact, 100% of the initial responder cells to CpG ODN stimulation in rhesus monkey PBMC cultures were PDC.

The ability to detect IFN-{alpha} producing PDC by flow cytometry in rhesus monkey PBMC after CpG ODN stimulation was related to the kinetics and the magnitude of IFN-{alpha} mRNA induction. There was a significant dose-dependent increase in IFN-{alpha} mRNA levels in CpG-A ODN-stimulated PBMC but a statistically significant dose-dependent decrease in IFN-{alpha} mRNA levels in CpG-B-stimulated PBMC. Stimulation of rhesus monkey PBMC with CpG-C ODN resulted in a dose response pattern intermediate between those of CpG-A and CpG-B ODN. Importantly, the dose-dependent inhibition of the IFN-{alpha} responses observed after CpG-B ODN stimulation was specific, as there was no apparent dose-dependent decrease in mRNA levels of several proinflammatory cytokines. It has been reported previously that high concentrations of CpG-B ODN result in reduced IFN-{alpha} production by murine dendritic cells (26, 27).

Although the differences in the kind and magnitude of the responses induced by the different CpG ODN classes have been well documented for mice, nonhuman primates, and humans (33, 35, 37, 38, 63-65), the underlying molecular mechanism(s) regulating these different responses has not been fully elucidated. It is well established that the early IFN-{alpha} response depends on activation of IRF-3, but a sustained response and the induction of IFN-{alpha} subtypes and ISG requires the activation of both IRF-3 and IRF-7 (7, 41, 59-61). In the present study, rhesus monkey PBMC IRF-3 mRNA levels did not change in response to CpG ODN stimulation, as was expected given the constitutive expression of this gene. In contrast, IRF-5 and IRF-7 mRNA levels increased after stimulation with all three classes of CpG ODN. While there was no difference in the kinetics or magnitude of elevated IRF-5 mRNA levels after stimulation with CpG-A, CpG-B, or CpG-C ODN, the highest IRF-7 mRNA levels were induced by CpG-A ODN. Although the early increase in IFN-{alpha} mRNA levels was apparently independent of increased IRF-7 mRNA levels, the more prolonged elevation of IFN-{alpha} mRNA levels and higher IFN-{alpha} protein levels after CpG-A ODN stimulation were associated with higher mRNA levels of IRF-7. Further, despite similar frequencies of IFN-{alpha}-producing cells after stimulation of rhesus monkey PBMC with each class of CpG ODN (as detected by ICC), only minimal levels of IFN-{alpha} protein were detected by ELISA after CpG-B ODN stimulation. The most likely explanation is that the transient induction of IFN-{alpha} mRNA levels after CpG-B ODN stimulation was not sufficient in duration to result in detectable protein secretion. Although the IFN-{alpha} ELISA data should not be overinterpreted, as the observed IFN-{alpha} protein levels after CpG ODN stimulation of rhesus monkey PBMC are considerably lower than IFN-{alpha} protein levels observed after stimulation of human PBMC with the same CpG ODN and the cross-reactivity of the used human IFN-{alpha} ELISA kit with rhesus monkey IFN-{alpha} has not been clearly established, IFN-{alpha} protein levels were significantly higher in CpG-A ODN-stimulated PBMC than in PBMC stimulated with CpG-B and CpG-C ODN.

Importantly, the sustained IFN-{alpha} response induced by CpG-A ODN resulting from the marked increase in IRF-7 mRNA levels was associated with the greatest increase in OAS and IP-10/CXCL10 mRNA levels. It has been previously demonstrated that the induction of IP-10/CXCL10 in human PDC in response to CpG ODN stimulation is dependent on IFN-{alpha} production (13). Thus, the observed increase in the mRNA levels of several interferon-stimulated genes and the detection of IP-10/CXCL10 protein at levels comparable to those observed for human PBMC after CpG ODN stimulation (13) confirm that CpG ODN can induce IFN-{alpha} responses in rhesus monkey PBMC.

However, while the differences in IRF-7 mRNA levels after CpG-A ODN stimulation and after CpG-B and CpG-C stimulation are potentially important, they did not reach statistical significance. Thus, differences in IRF-7 mRNA expression levels can only partially account for the more prolonged IFN-{alpha} response and the stronger induction of ISG in CpG-A ODN-stimulated PBMC. In fact, while CpG-A and CpG-C ODN induced a strong and sustained IFN-{alpha} response, CpG-B ODN stimulation resulted in the induction of several proinflammatory cytokines. Thus, it is likely that the selective induction of different transcription factors by CpG-A, CpG-B, and CpG-C ODN are responsible for the distinct gene expression patterns observed.

Our results suggest that the different types of CpG ODN induce different post-TLR9 signaling pathways, resulting in different gene expression patterns. CpG-A ODN were most effective in inducing IFN-{alpha}/ß genes, but CpG-B ODN were most potent in the induction of proinflammatory cytokine genes and immunoregulatory cytokines associated with the development of adaptive immune responses. CpG-C ODN-induced gene expression patterns were intermediate between those of CpG-A and CpG-B ODN, resulting in the induction of IFN-{alpha}/ß and proinflammatory cytokines.

The distinct nature of the innate immune response to each class of CpG ODN indicates that each class of CpG ODN may have specific clinical applications. The choice of CpG ODN will depend on the type of pathogen and the nature of host immune mechanisms responsible for pathogen clearance. CpG-B ODN induce proinflammatory cytokines and chemokines that result in the activation and recruitment of various immune effector cells. While this response probably contributes to the excellent vaccine adjuvant properties of B class CpG ODN, the inflammatory response may be detrimental in settings where immune activation favors pathogen replication, as was observed for CpG-B ODN treated mice that were challenged with Friends retrovirus (50).

In contrast, CpG-A and CpG-C ODN are potent inducers of the antiviral cytokine IFN-{alpha} and of IFN-{alpha}-induced antiviral effector molecules. As CpG-A ODN are difficult to produce, C class CpG ODN appear to be the most likely candidates for development as immunomodulatory agents for the prevention of viral diseases. Ultimately, the utility of the different CpG ODN classes for this purpose can be addressed only by conducting in vivo challenge studies with relevant nonhuman primate models of human infectious diseases.


    ACKNOWLEDGMENTS
 
We thank Carol Oxford and Jun Li for help in the cell sorting experiment and the Immunology Core laboratory at the CNPRC.

This work was supported by NIH grant DE016541-01 to K.A., NIH grants AI44480, RR14555, AI055793, and AI57264 to C.J.M., NIH grant AI26806 and amfAR grant 106449-34-RGIM to P.F.-B., and the CNPRC base grant U51RR00169.


    FOOTNOTES
 
* Corresponding author. Mailing address: UC Davis—CCM/CNPRC, County Rd. 98/Hutchison Dr., Davis, CA 95616. Phone: (530) 754-5673. Fax: (530) 754-4411. E-mail: kabel{at}ucdavis.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abel, K., M. J. Alegria-Hartman, K. Rothaeusler, M. Marthas, and C. J. Miller. 2002. The relationship between simian immunodeficiency virus RNA levels and the mRNA levels of alpha/beta interferons (IFN-{alpha}/ß) and IFN-{alpha}/ß-inducible Mx in lymphoid tissues of rhesus macaques during acute and chronic infection. J. Virol. 76:8433-8445.[Abstract/Free Full Text]
  2. Abel, K., M. J. Alegria-Hartman, K. Zanotto, M. B. McChesney, M. L. Marthas, and C. J. Miller. 2001. Anatomic site and immune function correlate with relative cytokine mRNA expression levels in lymphoid tissues of normal rhesus macaques. Cytokine 16:191-204.[CrossRef][Medline]
  3. Abel, K., L. Compton, T. Rourke, D. Montefiori, D. Lu, K. Rothaeusler, L. Fritts, K. Bost, and C. J. Miller. 2003. Simian-human immunodeficiency virus SHIV89.6-induced protection against intravaginal challenge with pathogenic SIVmac239 is independent of the route of immunization and is associated with a combination of cytotoxic T-lymphocyte and alpha interferon responses. J. Virol. 77:3099-3118.[Abstract/Free Full Text]
  4. Abel, K., L. La Franco-Scheuch, T. Rourke, Z. M. Ma, V. De Silva, B. Fallert, L. Beckett, T. A. Reinhart, and C. J. Miller. 2004. Gamma interferon-mediated inflammation is associated with lack of protection from intravaginal simian immunodeficiency virus SIVmac239 challenge in simian-human immunodeficiency virus 89.6-immunized rhesus macaques. J. Virol. 78:841-854.[Abstract/Free Full Text]
  5. Agrawal, S., and E. R. Kandimalla. 2002. Medicinal chemistry and therapeutic potential of CpG DNA. Trends Mol. Med. 8:114-121.[CrossRef][Medline]
  6. Akbar, A. N., J. M. Lord, and M. Salmon. 2000. IFN-{alpha} and IFN-ß: a link between immune memory and chronic inflammation. Immunol. Today 21:337-342.[CrossRef][Medline]
  7. Barnes, B., B. Lubyova, and P. M. Pitha. 2002. On the role of IRF in host defense. J. Interferon Cytokine Res. 22:59-71.[CrossRef][Medline]
  8. Barnes, B. J., P. A. Moore, and P. M. Pitha. 2001. Virus-specific activation of a novel interferon regulatory factor, IRF-5, results in the induction of distinct interferon alpha genes. J. Biol. Chem. 276:23382-23390.[Abstract/Free Full Text]
  9. Baskin, C. R., A. Garcia-Sastre, T. M. Tumpey, H. Bielefeldt-Ohmann, V. S. Carter, E. Nistal-Villan, and M. G. Katze. 2004. Integration of clinical data, pathology, and cDNA microarrays in influenza virus-infected pigtailed macaques (Macaca nemestrina). J. Virol. 78:10420-10432.[Abstract/Free Full Text]
  10. Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, and G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98:9237-9242.[Abstract/Free Full Text]
  11. Belardelli, F., and I. Gresser. 1996. The neglected role of type I interferon in the T-cell response: implications for its clinical use. Immunol. Today 17:369-372.[CrossRef][Medline]
  12. Biron, C. A. 1998. Role of early cytokines, including alpha and beta interferons (IFN-{alpha}/ß), in innate and adaptive immune responses to viral infections. Semin. Immunol. 10:383-390.[CrossRef][Medline]
  13. Blackwell, S. E., and A. M. Krieg. 2003. CpG-A-induced monocyte IFN-{gamma}-inducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-{alpha}. J. Immunol. 170:4061-4068.[Abstract/Free Full Text]
  14. Brinkmann, V., T. Geiger, S. Alkan, and C. H. Heusser. 1993. Interferon alpha increases the frequency of interferon gamma-producing human CD4+ T cells. J. Exp. Med. 178:1655-1663.[Abstract/Free Full Text]
  15. Chung, E., S. B. Amrute, K. Abel, G. Gupta, Y. Wang, C. J. Miller, and P. Fitzgerald-Bocarsly. 2005. Characterization of virus-responsive plasmacytoid dendritic cells in the rhesus macaque. Clin. Diagn. Lab. Immunol. 12:426-435,[Abstract/Free Full Text]
  16. Coates, P. T., S. M. Barratt-Boyes, L. Zhang, V. S. Donnenberg, P. J. O'Connell, A. J. Logar, F. J. Duncan, M. Murphey-Corb, A. D. Donnenberg, A. E. Morelli, C. R. Maliszewski, and A. W. Thomson. 2003. Dendritic cell subsets in blood and lymphoid tissue of rhesus monkeys and their mobilization with Flt3 ligand. Blood 102:2513-2521.[Abstract/Free Full Text]
  17. Cooper, C. L., H. L. Davis, M. L. Morris, S. M. Efler, A. M. Krieg, Y. Li, C. Laframboise, M. J. Al Adhami, Y. Khaliq, I. Seguin, and D. W. Cameron. 2004. Safety and immunogenicity of CPG 7909 injection as an adjuvant to Fluarix influenza vaccine. Vaccine 22:3136-3143.[CrossRef][Medline]
  18. Cousens, L. P., R. Peterson, S. Hsu, A. Dorner, J. D. Altman, R. Ahmed, and C. A. Biron. 1999. Two roads diverged: interferon {alpha}/ß- and interleukin 12-mediated pathways in promoting T cell interferon {gamma} responses during viral infection. J. Exp. Med. 189:1315-1328.[Abstract/Free Full Text]
  19. Feldman, S., D. Stein, S. Amrute, T. Denny, Z. Garcia, P. Kloser, Y. Sun, N. Megjugorac, and P. Fitzgerald-Bocarsly. 2001. Decreased interferon-alpha production in HIV-infected patients correlates with numerical and functional deficiencies in circulating type 2 dendritic cell precursors. Clin. Immunol. 101:201-210.[CrossRef][Medline]
  20. Geisbert, T. W., and P. B. Jahrling. 2004. Exotic emerging viral diseases: progress and challenges. Nat. Med. 10:S110-S121.[CrossRef][Medline]
  21. Gierynska, M., U. Kumaraguru, S. K. Eo, S. Lee, A. Krieg, and B. T. Rouse. 2002. Induction of CD8 T-cell-specific systemic and mucosal immunity against herpes simplex virus with CpG-peptide complexes. J. Virol. 76:6568-6576.[Abstract/Free Full Text]
  22. Halperin, S. A., G. Van Nest, B. Smith, S. Abtahi, H. Whiley, and J. J. Eiden. 2003. A phase I study of the safety and immunogenicity of recombinant hepatitis B surface antigen co-administered with an immunostimulatory phosphorothioate oligonucleotide adjuvant. Vaccine 21:2461-2467.[CrossRef][Medline]
  23. Harandi, A. M., K. Eriksson, and J. Holmgren. 2003. A protective role of locally administered immunostimulatory CpG oligodeoxynucleotide in a mouse model of genital herpes infection. J. Virol. 77:953-962.
  24. Hartmann, G., J. Battiany, H. Poeck, M. Wagner, M. Kerkmann, N. Lubenow, S. Rothenfusser, and S. Endres. 2003. Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-{alpha} induction in plasmacytoid dendritic cells. Eur. J. Immunol. 33:1633-1641.[CrossRef][Medline]
  25. Hartmann, G., R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, H. L. Davis, and A. M. Krieg. 2000. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 164:1617-1624.[Abstract/Free Full Text]
  26. Hemmi, H., T. Kaisho, K. Takeda, and S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170:3059-3064.[Abstract/Free Full Text]
  27. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740-745.[CrossRef][Medline]
  28. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann. 2002. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531-4537.[Abstract/Free Full Text]
  29. Isaacs, A., and J. Lindenmann. 1957. Virus interference. I. The interferon. Proc. R. Soc. Ser. B (London) 147:258-267.
  30. Izaguirre, A., B. J. Barnes, S. Amrute, W. S. Yeow, N. Megjugorac, J. Dai, D. Feng, E. Chung,