Previous Article | Next Article 
Clinical and Diagnostic Laboratory Immunology, May 2005, p. 581-585, Vol. 12, No. 5
1071-412X/05/$08.00+0 doi:10.1128/CDLI.12.5.581-585.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Immunoglobulin E Reactivity of Recombinant Allergen Tyr p 13 from Tyrophagus putrescentiae Homologous to Fatty Acid Binding Protein
Kyoung Yong Jeong,1,
Woo Kyung Kim,2,
Jae Sik Lee,1
Jongweon Lee,1
In-Yong Lee,1
Kyu-Earn Kim,3
Jung Won Park,4
Chein-Soo Hong,4
Han-Il Ree,1 and
Tai-Soon Yong1*
Department of Parasitology and Institute of Tropical Medicine, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul, Korea,1
Department of Pediatrics and Inje University Seoul Paik Hospital, Seoul, Korea,2
Department of Pediatrics and Institute of Allergy, Yonsei University College of Medicine, Seoul, Korea,3
Department of Internal Medicine and Institute of Allergy, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul, Korea4
Received 7 December 2004/
Returned for modification 18 January 2005/
Accepted 10 March 2005

ABSTRACT
The storage mite,
Tyrophagus putrescentiae, is one of the important
causes of allergic disorders. Fifteen allergenic components
were demonstrated in storage mite by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis and immunoblotting, but only the group 2
allergen Tyr p 2 has been cloned and characterized. In this
study, we attempted to identify and characterize new allergens
from
T. putrescentiae, which is a dominant species of storage
mite in Korea. Expressed sequence tags were analyzed to identify
possible storage mite allergens, and the cDNA sequence encoding
a protein homologous to fatty acid binding protein, a mite group
13 allergen, was identified and named Tyr p 13. Its deduced
amino acid sequence showed 61.1 to 85.3% identity with other
mite group 13 allergens. The recombinant protein was expressed
in
Escherichia coli using a pET 28b vector system, and its allergenicity
was investigated by enzyme-linked immunosorbent assay (ELISA).
The recombinant allergen was detected in 5 of 78 (6.4%)
T. putrescentiae-positive
sera tested, and it inhibited 61.9% of immunoglobulin E binding
to crude extract at an inhibitor concentration of 10 µg/ml
by inhibition ELISA using serum from the patient who showed
the strongest reaction by ELISA. In this study, a novel allergen
was identified in
T. putrescentiae. This allergen could be helpful
for more-detailed characterizations of storage mite allergy.

INTRODUCTION
The storage mite,
Tyrophagus putrescentiae, is found in stored
products such as dried eggs, ham, herring meal, cheese, and
different kinds of nuts (
17). Storage mites are the cause of
occupational allergic diseases of bakers (
21) and food industrial
workers (
2,
25) and among residents in agricultural environments
(
4). Koreans store uncooked rice in rice bins or chests in their
homes, and thus the storage mite,
T. putrescentiae, is often
found on kitchen floors in urban areas (
10). By crossed immunoelectrophoresis
using the sera from occupationally exposed farmers, 14 different
allergenic components were identified from the whole-body extract
of
T. putrescentiae (
1). However, less is known about the molecular
nature of the allergens derived from
T. putrescentiae. Only
the group 2 allergen Tyr p 2 has been cloned and characterized
from
T. putrescentiae (
6), although 20 groups of mite allergens
have been cloned to date (
26).
cDNA library screening and phage display technology have recently being utilized to identify and clone new allergens (7). However, both of these strategies have obvious limitations, i.e., due to posttranslational modifications and improper protein folding. In a previous study, 15 allergenic components were demonstrated in T. putrescentiae by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting, and a 16-kDa allergen was found to be most prevalent (52%) (18). In addition, considerable cross-reactivity between T. putrescentiae and Dermatophagoides species was demonstrated by inhibition enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis (16).
A cDNA sequence encoding a protein homologous to fatty acid binding protein, mite group 13 allergen, was identified by analyzing the expressed sequence tag data of T. putrescentiae. Mite group 13 allergens have been cloned and characterized from Blomia tropicalis (Blo t 13) (5), Acarus siro (Aca s 13) (8), and Lepidoglyphus destructor (Lep d 13) (7). The cross-reactivity of the Blo t 13 with other dust mites was also demonstrated using monoclonal antibodies (14).
In this study, we undertook to produce a recombinant fatty acid binding protein and then characterize the allergenic properties of this protein from T. putrescentiae.

MATERIALS AND METHODS
Preparation of crude extract.
The allergen extract was prepared by using phosphate-buffered
saline (PBS) and protease inhibitors. Thirty grams of frozen
mites which had been reared as described previously (
20) was
homogenized in liquid nitrogen. The sample was defatted in 200
ml of a 1:1 volume of ethyl ether and ethyl acetate, and 1 mg
of 1-phenyl-3-(2-thiazolyl)-2-thiourea (Sigma, St. Louis, Mo.)
was added to prevent melanization. The proteins was extracted
with slow overhead stirring at 4°C overnight in phosphate-buffered
saline (PBS), pH 7.4, containing 6 mM 2-mercaptoethanol and
a 1/1,000 volume of protease inhibitor set III (Calbiochem,
San Diego, CA). The extract was then centrifuged at 10,000
x g for 30 min at 4°C, and the supernatant was filtered through
a 0.22-µm syringe filter (Millipore, Bedford, MA). The
protein content was determined by the Bradford assay (Bio-Rad,
Hercules, CA) using bovine serum albumin as a standard. The
extract was used for the ELISA and skin prick tests. For the
skin prick test, it was dialyzed in modified Coca solution (0.9%
NaCl, 0.25% NaHCO
3, 0.04% phenol), and diluted extract at a
final concentration of 0.2 mg/ml was used for the test. The
tip of a 20-gauge needle was introduced through a drop of the
extract into the superficial layers of the skin, which were
gently lifted. Wheals larger than 3 mm after 15 min were considered
indicative of a positive reaction. All tests included 1 mg/ml
histamine dihydrochloride (Bayer) as a positive control and
albumin-saline with phenol (Bayer) as a negative control.
Subjects and serum samples.
A total of 456 patients participated in this study. Of these patients, 432 were 3 to 15 years old (male:female ratio = 223:209; average age, 8 years), and all were seen at the Pediatric Clinic at Inje University Seoul Paik Hospital, Seoul, Korea. Twenty-four patients (male:female ratio = 16:8, average age, 29 years) who attended the Allergy Clinic at Severance Hospital, Yonsei University, Seoul, Korea, were also included. All the subjects were examined by skin prick testing using extracts of Dermatophagoides pteronyssinus, D. farinae, Blattella germanica, Periplaneta americana, cat dander, dog hair, Alternaria tenuis, Penicillium mix, alder, oak, and ragweed (Bencard Co., Gaggenau, Germany). The extract of T. putrescentiae prepared as described in the above section was also included. All sera obtained from test participants underwent ELISA testing, and the serum samples obtained from subjects who showed a negative reaction both in the skin prick test and ELISA were used for the negative control experiments.
cDNA cloning of fatty acid binding protein.
A cDNA sequence encoding a protein homologous to fatty acid binding protein was obtained by the analyzing T. putrescentiae expressed sequence tags. A cDNA library of T. putrescentiae was constructed using a ZAP Express cDNA Gigapack II gold cloning kit (Stratagene, La Jolla, CA).
Expression and purification of recombinant allergen.
The open reading frame of fatty acid binding protein was amplified by PCR using a primer set (Tp13F [ATGGTTCAACTGAACGGCTC] and Tp13R [CTGTTTACTGGCGCTTGTAG]), subcloned into pGEM T Easy vector (Promega, Madison, WI), and subsequently transferred into the EcoRI site of pET 28 b vector (Novagen, Madison, WI). The orientation of the insert was confirmed by PCR annealing T7 primer to the vector and annealing Tp13R primer to the insert. The expressed protein contained the additional 36 amino acids derived from pET 28b vector and 3 amino acids from pGEM T Easy vector (MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRDPNSLVI) at its N terminus. Recombinant protein was expressed in Escherichia coli BL21(DE3) and purified by Ni-nitrilotriacetic acid agarose (QIAGEN, Valencia, CA) affinity column chromatography under denaturing conditions (9).
IgE reactivity of the recombinant allergen.
The reactivities of specific immunoglobulin E (IgE) antibodies to the recombinant allergen were examined by ELISA. ELISA plates were coated with 100 µl (0.1 M sodium carbonate, pH 9.6) of 2 µg/ml of recombinant Tyr p 13, and plates were washed three times with PBS containing 0.05% Tween 20 (PBST) and blocked with 3% skim milk in PBST for 1 h. Subsequently, the plates were incubated with 50 µl/well of 1:4 (in PBST containing 1% bovine serum albumin)-diluted sera for 1 h. IgE antibodies were detected using biotinylated goat anti-human IgE (epsilon chain specific; Vector, Burlingame, CA) and streptavidin-peroxidase (Sigma). The signal was developed using 3,3',5,5'-tetramethylbenzidine (Kirkegaard & Perry Laboratories, Gaithersburg, MD). The mean absorbance plus 2 standard deviations of the sera of 18 healthy controls was used as a cutoff value.
For the inhibition test, 100 µl of 20 µg/ml of extract was coated overnight at 4°C. The 1:4-diluted serum was preincubated with various quantities of crude extract or recombinant protein for 2 h at room temperature and overnight at 4°C. IgE antibodies were detected as described above.

RESULTS
Skin prick test.
A total of 432 pediatric subjects (male:female ratio = 223:209,
average age, 8 ± 3 years, mean ± 1 standard deviation)
was enrolled in this study; 358 children suffered from asthma,
325 from allergic rhinitis, 17 from atopic dermatitis, and six
children from urticaria. By skin prick testing, 69.5% had positive
responses to
D. pteronyssinus, 57.8% to
D. farinae, 34.2% to
B. germanica, 22.3% to
P. americana, 16.3% to cat dander, 15.7%
to
Alternaria, 12.8% to dog hair, 12.7% to
T. putrescentiae,
6.0% to
Penicillium, 5.3% to oak, 4.4% to ragweed, and 4.2%
to alder.
Among these, 55 children (male:female ratio = 26:29) showed positive reactions to T. putrescentiae. The mean total IgE level of these 55 children was 708.03 ± 522.79 (ranging from 11.2 to 2,960) IU/ml, and the mean eosinophil count was 493.07 ± 264.56/mm3 (ranging from 82 to 1,430). Twenty-four adult patients (9 patients suffering from allergic asthma, 6 from urticaria, 3 from allergic rhinitis, 3 both from allergic asthma and allergic rhinitis, 2 from severe coughing, and 1 from atopic dermatitis) with a mean total IgE of 501.33 ± 645.82 (ranging from 13.9 to 4,530) IU/ml and a mean eosinophil count of 449.01 ± 283.13/mm3 (ranging from 130 to 1,120) also showed a positive reaction to T. putrescentiae.
Analysis of expressed sequence tag database.
A total of 382 readable amino acid encoding sequences were produced from 446 clones in the of T. putrescentiae cDNA library. A BLASTX search of 22 clones showed high homology to the previously known allergens. Seven different groups of mite allergens were identified, and three clones showed significant homology to cockroach group 6 allergen (Table 1).
Homology to fatty acid binding proteins.
Eight clones out of 446 analyzed were found to be homologous
to fatty acid binding protein, and 6 clones contained the full-length
open reading frame. The complete sequence was found to be 643
nucleotides in length (Fig.
1) and included a 5' noncoding region
of 59 bp, a 3' untranslated region of 184 bp, and an open reading
frame of 396 bp. This open reading frame codes for a 132 amino
acid protein with a calculated molecular mass of 14.57 kDa and
an isoelectrical point of 7.22. A cytosolic fatty acid binding
protein signature at amino acid residues 5 to 22 was detected
using the PROSITE program (
http://www.isb-sib.ch/announce/).
The protein also contains a potential N-glycosylation site at
position 5 to 7, and a putative polyadenylation signal was found
between nucleotide residues 542 and 548.
The amino acid sequence of the putative fatty acid binding protein
from
T. putrescentiae shows 85.3% identity with Aca s 13 from
A. siro, 62.3% identity with Blo t 13 from
B. tropicalis, and
61.1% identity with Lep d 13 from
L. destructor (Fig.
2). Due
to its high homology with mite group 13 allergens and in accord
with the allergen nomenclature (
13), it was named Tyr p 13.
Expression and IgE binding of recombinant Tyr p 13.
Recombinant Tyr p 13 with a short N-terminal fusion protein
which includes 6-histidine was expressed in
E. coli and metal
affinity purified (Fig.
3). The yield of recombinant Tyr p 13
was 5.432 mg/liter bacterial culture as determined by Bradford
assay. The recombinant allergen was detected by IgE antibodies
in 5 of the 78 (6.41%)
T. putrescentiae-positive sera tested
(Fig.
4).
Inhibition of IgE reactivity by the recombinant protein.
This inhibition study was performed using the serum from the
patient who showed the strongest IgE reactivity to the recombinant
allergen. The crude extract inhibited a maximum IgE reactivity
by 95.7%, whereas the recombinant allergen inhibited it by 61.9%
at an inhibition concentration of 10 µg/ml (Fig.
5).

DISCUSSION
Fatty acid binding proteins has been described as a putative
vaccine candidate for some parasitosis-inducing species such
as
Fasciola hepatica (
22),
Schistosoma japonica (
3), and
Schistosoma mansoni (
24). The first fatty acid binding protein reported
as an allergen was the ABA-1 of
Ascaris suum (
23). It was also
found that a small number of low-molecular-weight proteins which
share the similarity with fatty acid binding proteins are highly
up-regulated in psoriatic skin (
15). Even though they bear no
significant homology with ABA-1, several proteins homologous
to fatty acid binding proteins from dust mites have been known
to be allergenic (group 13). However, the frequencies of IgE
binding to these allergens are low, suggesting that they are
minor allergens, e.g., 11% (5 of 45) to Blo t 13 from
Blomia tropicalis (
5), 23% (3 of 13) to Aca s 13 from
Acarus siro (
8),
and 13% (6 of 45) to Lep d 13 from
Lepidoglyphus destructor (
7). However, recombinant Blo t 13 inhibited 62% of IgE binding
to crude extract according to the radioallergosorbent inhibition
test using one patient's serum, which suggests that it may be
clinically significant for some patients. In the present study,
a 6.41% (5 of 78) IgE binding frequency to recombinant Tyr p
13 was observed and recombinant Tyr p 13 at 10 µg/ml inhibited
61.9% of IgE binding to the crude extract by inhibition ELISA
using the serum from the patient who showed the strongest reaction
to recombinant Tyr p 13. However, more biochemical analysis
is necessary because N-glycosylation of the allergen may have
affected its allergenicity. Furthermore, patients from rural
area or bakers who are more likely to be sensitized to storage
mite allergens may show different allergic responses to this
molecule.
Until now, the diagnosis of allergic disorders has mainly been based on crude extracts. Allergen extracts have several limitations such as batch-to-batch variations and difficulty in standardization. Moreover, false-positive reactions may occur because of the nonallergenic compounds. In addition, skin prick testing using T. putrescentiae commercial allergen extract is not believed to be reliable for the detection of measurable levels of IgE antibodies (11). Thus, the cloning and genetic engineering of the allergens offers many advantages, and they are expected to replace crude extracts for diagnosis and treatment in the near future (12).
In a study using a panel of seven purified natural or recombinant allergens, mite-allergic patients who were polysensitized to various minor allergens, which included highly cross-reactive allergens and storage mite allergens, could be discriminated from those who were mainly sensitized to major allergens (e.g., Der p 1 and Der p 2) (19). This is important, as atopic individuals polysensitized to many minor allergens are less likely to benefit from immunotherapy based on crude allergen extracts. Therefore it is necessary to characterize minor allergens in more detail, especially with respect to allergenicity and cross-reactivity. Detailed characterization of the minor allergens may lead us to the more-beneficial immunotherapeutic approaches.
More clones are being analyzed in an effort to characterize T. putrescentiae allergens in detail, and possible allergens identified by expressed sequence tag analysis are now being investigated. Moreover, the clinical relevance of Tyr p 13 remains to be evaluated in vivo. It is hoped that the use of recombinant Tyr p 13 in combination with other allergens could improve the diagnostic specificity.

ACKNOWLEDGMENTS
This study was supported by the Brain Korea 21 Project for Medical
Science, Yonsei University.

FOOTNOTES
* Corresponding author. Mailing address: Department of Parasitology and Institute of Tropical Medicine, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul 120-752, Korea. Fax: 82-2-363-8676. Phone: 82-2-361-5290. E-mail:
tsyong212{at}yumc.yonsei.ac.kr.

K.Y.J. and W.K.K. contributed equally to this study. 

REFERENCES
1 - Arlian, L. G., D. L. Vyszenski-Moher, S. G. O. Johasson, and M. van Hage-Hamsten. 1997. Allergenic characterization of Tyrophagus putrescentiae using sera from occupationally exposed farmers. Ann. Allergy Asthma Immunol. 79:525-529.[Medline]
2 - Armentisa, L. G., D. L. Vyszenski-Moher, S. G. O. Johansson, and M. van Hage-Hamsten. 1994. Allergenic characterization of Tyrophagus putrescentiae using sera from occupationally exposed farmers. Ann. Allergy Asthma Immunol. 22:152-154.
3 - Becker, M. M., B. H. Kalinna, G. J. Waine, and D. P. McManus. 1994. Gene cloning, overproduction and purification of a functionally active cytoplasmic fatty acid-binding protein (Sj-FABPC) from the human blood fluke Schistosoma. Gene 148:321-325.[CrossRef][Medline]
4 - Blainey, A. D., M. D. Topping, S. Ollier, and R. J. Davies. 1989. Allergic respiratory disease in grain workers: the role of storage mites. J. Allergy Clin. Immunol. 84:296-303.[CrossRef][Medline]
5 - Caraballo, L., L. Puerta, S. Jimenez, B. Martinez, D. Mercado, A. Avjiouglu, and D. Marsh. 1997. Cloning and IgE binding of a recombinant allergen from the mite Blomia tropicalis, homologous with fatty acid-binding proteins. Int. Arch. Allergy Immunol. 112:341-347.[Medline]
6 - Eriksson, T. L., E. Johansson, P. Whitley, M. Schmidt, S. Elsayed, and M. van Hage-Hamsten. 1998. Cloning and characterization of a group II allergen from the dust mite Tyrophagus putrescentiae. Eur. J. Biochem. 251:443-447.[Medline]
7 - Eriksson, T. L. J., O. Rasool, S. Huecas, P. Whitley, R. Crameri, U. Appenzeller, G. Gafvlein, and M. van Hage-Hamsten. 2001. Cloning of three new allergens from the dust mite Lepidoglyphus destructor using phage surface display technology. Eur. J. Biochem. 268:287-294.[Medline]
8 - Eriksson, T. L. J., P. Whitley, E. Johansson, M. van Hage-Hamsten, and G. Gafvelin. 1999. Identification and characterization of two allergens from the dust mite Acarus siro, homologous with fatty acid-binding proteins. Int. Arch. Allergy Immunol. 119:275-281.[CrossRef][Medline]
9 - Janknecht, R., G. de Martynoff, J. Lou, R. A. Hipskind, A. Nordheim, and H. G. Stunnenberg. 1991. Rapid and efficient purification of native histidine-tagged protein expressed by recombinant vaccine virus. Proc. Natl. Acad. Sci. USA 88:8972-8976.[Abstract/Free Full Text]
10 - Jeong, K. Y., I. Y. Lee, J. Lee, H. I. Ree, C. S. Hong, and T. S. Yong. Effectiveness of health education for the control of house dust mites and cockroaches in Seoul, Korea. Med. Vet. Entomol. (In press.)
11 - Kanceljak-Macan, B., J. Macan, D. Plavec, T. Klepac, and S. Milkovic-Kraus. 2002. The 3 mm skin prick test (SPT) threshold criterion is not reliable for Tyrophagus putrescentiae: the re-evaluation of SPT criterion to dust mites. Allergy 57:1187-1190.[CrossRef][Medline]
12 - Kazemi-Shrazi, L., V. Niederberger, B. Linhart, J. Lidholm, D. Kraft, and R. Valenta. 2002. Recombinant marker allergen: diagnostic gatekeepers for the treatment of allergy. Int. Arch. Allergy Immunol. 127:259-268.[CrossRef][Medline]
13 - King, T. P., D. Hoffman, H. Lowenstein, D. G. Marsh, T. A. E. Platts-Mills, and W. Thomas. 1994. Allergen nomenclature. Int. Arch. Allergy Immunol. 105:224-233.[CrossRef][Medline]
14 - Labrada, M., K. Uyema, M. Sewer, A. Labrada, M. Gonzalez, L. Caraballo, and L. Puerta. 2002. Monoclonal antibodies against Blo t 13, a recombinant allergen from Blomia tropicalis. Int. Arch. Allergy Immunol. 129:212-218.[CrossRef][Medline]
15 - Madsen, P., H. H. Rasmussen, H. Leffers, B. Honore, and J. Celis. 1992. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FAB]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins. J. Investig. Dermatol. 99:299-305.[CrossRef][Medline]
16 - Munhbayarlah, S., J. W. Park, S. H. Ko, H. I. Ree, and C. S. Hong. 1998. Identification of Tyrophagus putrescentiae allergens and evaluation of cross-reactivity with Dermatophagoides pteronyssinus. Yonsei Med. J. 39:109-115.[Medline]
17 - Olsson, S., and M. van Hage-Hamsten. 2000. Allergens from house dust and storage mites: similarities and differences, with emphasis on the storage mite Lepidoglyphus destructor. Clin. Exp. Allergy 30:912-919.[CrossRef][Medline]
18 - Park, J. W., S. H. Ko, T. S. Yong, H. I. Ree, B. J. Jeoung, and C. S. Hong. 1999. Cross-reactivity of Tyrophagus putrescentiae with Dermatophagoides farinae and Dermatophagoides pteronyssinus in urban areas. Ann. Allergy Asthma Immunol. 83:533-539.[Medline]
19 - Pittner, G., S. Vrtala, W. R. Thomas, M. Weghofer, M. Kundi, F. Horak, D. Kraft, and R. Valenta. 2004. Component-resolved diagnosis of house-dust mite allergy with purified natural and recombinant mite allergens. Clin. Exp. Allergy 34:597-603.[CrossRef][Medline]
20 - Ree, H. I., and I. Y. Lee. 1997. Development of mass rearing technique of Tyrophagus putrescentiae (Acari: Acaridae) found in house dust. Korean J. Parasitol. 35:149-154.
21 - Revsbech, P., and M. Dueholm. 1990. Storage mite allergy among bakers. Allergy 45:204-208.[Medline]
22 - Rodriguez-Perez, J., J. R. Rodriguez-Medina, M. A. Garcia-Blanco, and G. V. Hillyer. 1992. Fasciola hepatica: molecular cloning nucleotide sequence and expression of a gene encoding a polypeptide homologous to a Schistosoma mansoni fatty acid binding protein. Exp. Parasitol. 74:400-407.[CrossRef][Medline]
23 - Spence, H. J., J. Moore, A. Brass, and M. W. Kennedy. 1993. A cDNA encoding repeating units of the ABA-1 allergen of Ascaris. Mol. Biochem. Parasitol. 57:339-344.[CrossRef][Medline]
24 - Tendler, M., C. A. Brito, M. M. Vilar, N. Serra-Freire, C. Diogo, M. S. Almeida, A. C. Delbem, J. F. Da Silva, W. Savino, R. C. Garratt, N. Katz, and A. S. Simpson. 1996. A Schistosoma mansoni fatty acid-binding protein, Sm14, is the potential basis of a dual-purpose anti-helminth vaccine. Proc. Natl. Acad. Sci. USA 93:269-273.[Abstract/Free Full Text]
25 - Terho, E. O., K. Husman, I. Vohlonen, M. Rautalahti, and H. Tukianen. 1985. Allergy to storage mites or cow dander as a cause of rhinitis among Finnish dairy farmers. Allergy 40:23-26.[Medline]
26 - Thomas, W. R., W. A. Smith, B. J. Hales, K. L. Mills, and R. M. O'Brien. 2002. Characterization and immunobiology of house dust mite allergens. Int. Arch. Allergy Immunol. 129:1-18.[CrossRef][Medline]
Clinical and Diagnostic Laboratory Immunology, May 2005, p. 581-585, Vol. 12, No. 5
1071-412X/05/$08.00+0 doi:10.1128/CDLI.12.5.581-585.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Jeong, K. Y., Lee, H., Lee, J. S., Lee, J., Lee, I.-Y., Ree, H.-I., Hong, C.-S., Park, J. W., Yong, T.-S.
(2005). Immunoglobulin E Binding Reactivity of a Recombinant Allergen Homologous to {alpha}-Tubulin from Tyrophagus putrescentiae. CVI
12: 1451-1454
[Abstract]
[Full Text]