Clinical and Diagnostic Laboratory Immunology, May 2005, p. 563-565, Vol. 12, No. 5
1071-412X/05/$08.00+0 doi:10.1128/CDLI.12.5.563-565.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
North Shore-Long Island Jewish Research Institute and Schneider Children's Hospital, North Shore-Long Island Jewish Health System, Manhasset, New York
Received 2 August 2004/ Returned for modification 29 October 2004/ Accepted 30 December 2004
|
|
|---|
|
|
|---|
Two types of cells are generated in the thymus. Most express a T-cell receptor composed of
and ß chains, but a small population expresses a receptor of
and
chains. All of these chains are encoded by variable (V), diversity (D), and junctional (J) gene segments, which are rearranged during T-cell development in a process called V (D) J recombination. This process involves cleavage of DNA at the recombination signal sequences that flank T-cell receptor gene segments in their germ line configuration. When the intervening stretches of DNA are excised, then the coding ends are joined to form a functional T-cell receptor gene in the chromosomal DNA, and the signal ends join to form extra chromosomal DNA circles termed T-cell receptor rearrangement excision circles (TRECs). The T-cell receptor-
locus is embedded in the T-cell receptor-
locus; so T-cell receptor-
sequences are specifically deleted in all
ß T cells. During T-cell receptor rearrangement there are two rearrangement events which happen, first producing a signal joint TREC and second producing a coding joint TREC (11).
In humans there is no known way to distinguish phenotypically between cells that have recently emigrated the thymus and long-lived naïve cells in the periphery. One proposed marker for recent thymic emigrants is the episomal DNA circle that is generated during excision rearrangement of T-cell receptor genes. TRECs are stable and are not duplicated during mitosis (3). Signal and coding joint TRECs are affected similarly in mature T cells.
Children with congenital heart diseases routinely undergo partial thymectomy during cardiac surgery for better visualization of structures. There have been few studies done to determine the effects of neonatal thymectomy in humans (1, 13). In the report focused on neonatal thymectomy in humans, Brearley et al. (1) had shown that in infants younger than 3 months of age thymectomy caused impaired immunity in late childhood and concluded that thymectomy in pediatric cardiac surgery should be avoided. Wells et al. (13) did not concur on this concept of preserving the thymus and showed that total number of T cells and CD4 cells dropped 12 months after thymectomy.
In chickens (7) levels of chT1+ cells (which correlated to TRECs) disappeared after complete thymectomy. In chickens with partial thymectomies the levels of chT1+ T cells in the circulation 4 weeks postthymectomy correlated directly with the numbers of residual thymic lobes.
There have been no studies done to determine what happens to TREC levels after partial thymectomy in children with congenital heart disease. This study was done to study the effect of partial thymectomy on TREC values. Partial thymectomy is defined as removal of 70 to 90% of thymic gland from the anterior mediastinum to facilitate exposure for cannulation for cardiopulmonary bypass.
|
|
|---|
Group B included patients undergoing reoperation for congenital heart disease. (Only post-partial thymectomy samples were collected from 8 patients, after an interval of 16 days to 6 years.)
Group C included patients with congenital heart disease undergoing cardiac catheterization. (Only pre-partial thymectomy samples were collected from 5 patients.)
No study patient carried the diagnosis of DiGeorge syndrome. No patients received steroids during the hospitalization.
Cell sources. Peripheral blood samples were drawn from patients. Three milliliters of whole blood was collected in sterile heparinized tubes processed within 24 h.
Cell isolation and quantification of TRECs by real-time PCR. Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll density gradient centrifugation. Cells lysates were prepared by proteinase K digestion TRECs were quantified by real-time PCR analysis, using the TaqMan 5 nuclease assay, and the ABI Prism 7700 sequence detection system (PE-Applied Biosystems). In brief, 0.5 µM primers (forward primer: CACATCCCTTTCAACCATGCT and reverse primer: GCCAGCTGCAGGGTTTAGG), 0.1 µM TaqMan probe (FAM-ACACCTCTGGTTTTTGTAAAGGTGCCCACT-TAMRA), 3.5 mM MgCl2, 0.2 mM deoxynucleoside triphosphates, 0.25 U of uracil DNA glycosylase, 0.625 U of Amplitaq Gold DNA polymerase in TaqMan buffer (PE Biosystem), and 100,250 ng of genomic DNA from PBMC were mixed together in a 25-L PCR mixture. PCR conditions were 50°C for 2 min, 95°C for 10 min, 95°C for 30 s, and 60°C for 1 min for 45 cycles. A standard curve was established with known copies of plasmids containing signal joint TREC fragment and TREC values for test samples were calculated with the software provided with the ABI Prism 7700 system (Sequence Detection System, version 1.6.3). Each sample was run in duplicate and mean TREC values were used for data analysis. Results were expressed as TRECs/106 cells.
Statistical analysis. The significance of differences between means in TREC values was determined by use of the Student t test, Wilcoxon signed rank sum test, and Mann-Whitney U test.
|
|
|---|
![]() View larger version (107K): [in a new window] |
FIG. 1. Mean TREC values/million PBMC pre- and post-partial thymectomy with standard deviation in group A patients (paired data).
|
TREC levels in patients in group C (n = 5) were 69,774 ± 33,601 (mean ± standard error of mean).
Although no statistical correlation was drawn between groups B and C as they included different patients, the overall pre-partial thymectomy TREC levels were higher than the post-partial thymectomy TREC levels.
|
|
|---|
In children, studies using TRECs have been performed in patients with primary and secondary immune deficiency diseases including human immunodeficiency virus (HIV)-infected infants and children (2, 8, 9). Patients with absent thymus, such as in severe combined immune deficiency disease or in complete DiGeorge syndrome have very low TRECs. In HIV-infected infants, TRECs in peripheral blood lymphocytes were decreased when compared to HIV-exposed, uninfected infants; after therapy the TREC levels increased to levels present in HIV-exposed, uninfected infants (2). In a recent study, TRECs were markedly reduced in patients many years after thymectomy in childhood, concurrently with decreases in total T cells and phenotypic naïve CD4 T cells (5).
In the present study the TREC levels significantly declined in all study patients post-partial thymectomy in the immediate postoperative period. The decreased TREC values seen in patients in the immediate postoperative period are probably due to several reasons, including decreased thymic output and changes in blood volume distributions. Overall the TREC values in patient groups without thymectomy were higher than the patients who had a partial thymectomy. The likelihood of a true decrease in TRECs resulting from decreased thymopoiesis is strengthened by the observation that even patients examined for periods up to six years post-partial theymectomy had lower TRECs than patients who did not have thymectomy. In the published study of Halnon et al. (5), patients with no residual thymus had significantly lower TRECs than those with partial thymectomy.
Whether the decrease in TREC in patients with partial or complete thymic removal also leads to a deficiency in thymic-derived regulatory T cells is unknown. The partial thymectomy in infancy and decrease in TRECs did not appear to adversely influence immune function, as there was no known autoimmune diseases in the study population over a short term follow up. Presumably, minimal residual thymic tissue post-partial thymectomy is sufficient for immune function.
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»