Novel Hairpin-Shaped Primer Assay To Study the Association of the -44 Single-Nucleotide Polymorphism of the DEFB1 Gene with Early-Onset Periodontal Disease

A powerful, cost-effective new method for studying single-nucleotidepolymorphisms (SNPs) is described. This method is based on theuse of hairpin-shaped primers (HP), which give a sensitive andspecific PCR amplification of each specific allele, withoutthe use of costly fluorophore-labeled probes and any post-PCRmanipulation. The amplification is monitored in real-time usingSYBR Green I dye and takes only 2 h to yield results. The HPassay has a simple design and utilizes a conventional real-timePCR apparatus. The –44 C $->$ G transversion in the DEFB1 gene(which encodes human ß-defensin 1) has been previouslyassociated with Candida carriage in oral epithelia. In thisstudy, we analyzed the association between early-onset periodontaldisease (EOP) and the –44 SNP. We used an HP assay tostudy the distribution of the –44 SNP in 264 human DNAsobtained from two cohorts of EOP patients and healthy controlsfrom different ethnic backgrounds. The results indicate thatthe –44 SNP has a similar distribution between EOP andhealthy patients, suggesting that it is not associated withthe disease.

INTRODUCTION

Top

Introduction

The completion of the Human Genome Project has led to researchersbecoming increasingly interested in studying single-nucleotidepolymorphisms (SNPs). SNPs are the most abundant form of geneticvariation between individuals; some have been observed to causeseveral diseases (e.g., sickle cell anemia [28]) and have beenproven to be useful tools for identifying genes involved incommon polygenic and multifactorial diseases (8). SNPs havealso proven to be useful tools for understanding the pathogenesisof several diseases (e.g., (4).

Most of the methods available for SNP detection, such as techniquesbased on mass spectrometry (20), high-pressure liquid chromatography(23), microarray analysis (6), Taqman probes (16), or molecularbeacons (25), are generally costly, time consuming, and/or difficultto automate, hindering their implementation in most laboratories.

The recently developed hairpin-shaped primer (HP) assay is afeasible alternative method for SNP detection, which is easyto implement in a wide variety of laboratories (10). This methodoffers an improved specificity over conventional amplificationrefractory mutation system (ARMS) assays (22) because it usesprimers that carry a 5'-end nucleotide tail complementary tothe 3' end of the SNP-detecting primer, creating a hairpin structure.This prevents nonspecific priming. The 3' end of the HP hybridizesto the SNP residue. Two HPs are designed, one complementaryto each allele, together with a common linear primer. Two PCRsare performed in parallel, each with one of the two HPs, usingthe same DNA template, and the amplification is monitored inreal time, by fluorescence increase, using the free fluorophoreSYBR green I. An HP that is fully complementary to the targetDNA will yield a more efficient amplification than a mismatchedreaction, leading to an earlier threshold cycle (C_t). The greaterthe difference between the C_ts of the mismatched and matchedprimer-template reactions ( ${Delta}$ C_t) for each HP, the more robustthe assay is. The technique has been developed and proven tobe effective in prokaryotic contexts (10). This study presentsthe first report of the application of a HP assay to SNP genotypingin a human disease.

Early-onset periodontal disease (EOP) is a complex multifactorialdisorder triggered by colonization of the oral epithelia bybacteria and yeasts, which leads to a gingival inflammation,loss of alveolar bone, and tooth loss (27). The importance ofthe protective role played by ß-defensins againstpathogenic microorganisms in oral epithelia has been discussedby several authors (5, 15, 18). Moreover, a recent observationby Putsep et al. on patients suffering from morbus Kostmann(24) highlights the role of antimicrobial peptides in periodontaldisease. Epidemiological studies clearly demonstrate that geneticfactors play a significant role in EOP (9, 21), underscoringthe importance of applying genetics approaches to study EOP.The C $->$ G transversion at position –44 of the DEFB1 gene(which encodes human ß-defensin 1) has been associatedwith Candida sp. carriage in the mouth (12) and with the riskof human immunodeficiency virus type 1 infection in the Caucasianpopulation (1).

In order to establish if the –44 SNP is associated withEOP, we studied its distribution in EOP patients and healthycontrols from two different ethnic backgrounds, using the HPassay.

MATERIALS AND METHODS

Top

Materials and Methods

DNA samples. Anonymous, historically acquired DNA from two cohorts comingfrom different ethnic backgrounds was analyzed. DNA samplesfrom 76 Caucasian EOP patients and 44 African-American EOP patientswere included in this study. As controls, DNA samples from 80ethnically and geographically matched healthy subjects wereincluded in the study.

PCRs. Primers were designed using the Primer Express 2.0 software(ABI, Foster City, Calif.), with reference to the publishedhuman genome sequence (GenBank accession number U50930). A tailwas added to the 5' end of the SNP-specific primers in orderto produce a stem with a melting temperature (T_m) of 67 to 70°Cand a variation of free energy of between –0.5 and –2.0,using the mfold software (http://www.bioinfo.rpi.edu/applications/mfold/old/dna/).

Sequences of the forward C- and G-allele-specific HPs are GGCTGGACCTCCAAtGGAGCCAGCCand CGCTGGACCTCCAAtGGAGCCAGCG, respectively, where the underlinedresidues correspond to the 5'-end tails, the bold upper-casecorresponds to the 3' SNP-specific residue, and the lowercasecorresponds to a secondary mutation inserted to improve thediscriminatory power of the assay. When used with the commonreverse primer (CAGGATTTCAGGAACTGGGGAG), the PCR yields a 45-bpamplicon. For each DNA sample, two real-time PCRs of 10 µlwere run in parallel, one with the C-allele-specific HP andthe other with the G-allele-specific HP. Each reaction contained1x PCR buffer II (ABI); 200 µM concentration each of dATP,dCTP, dGTP, and dTTP; 0.3 U of AmpliTaq Gold (ABI); 2 mM MgCl₂;5 pmol (each) primer; 1x SYBR Green I; 1.75 ng of 6-carboxyX-rhodamine; succinimidyl ester (Molecular Probes, Eugene, Ore.);and 10 ng of template DNA. All PCRs were run in a StratageneMX4000 real-time PCR instrument (Stratagene, La Jolla, Calif.).Thermal cycling conditions were as follows: stage 1, 95°Cfor 10 min, 70°C for 30 s; stage 2, 72°C for 30 s, 95°Cfor 20 s, 69°C for 30 s (lowering 1°C each cycle) for10 cycles; stage 3, 72°C for 30 s, 95°C for 20 s, 60°Cfor 30 s for 40 cycles. Data were collected in the last stepof stage 3 in order to calculate the C_t of each amplificationcurve.

As controls, we designed two 45-bp single-stranded oligonucleotideartificial templates, which match the target sequence of eachallele: tcagcctccaaaggagccagcC/Gtctccccagttcctgaaatcctg (theresidues shown in bold uppercase correspond to the SNP residues).For homozygous controls, each oligonucleotide was used separatelyas the template for a PCR (using 10⁶ molecules/reaction). A1:1 mix of both oligonucleotides was used as a C/G heterozygouscontrol, combining 5 x 10⁵ molecules of each per reaction.

DNA sequencing reactions. PCR amplification of the specific region containing –44C $->$ G was performed under the conditions previously described byJurevic et al. (13). DNA sequences were obtained with the BigDye Terminator sequencing kit (ABI), following the manufacturer'sinstructions.

Statistical analyses. The mean C_ts and the 95% confidence intervals (CI) were calculatedusing Microsoft Excel (Microsoft Corporation, Redmond, Wash.).

Gene frequencies were calculated from the observed number ofgenotypes. The significance of differences in allelic and genotypesfrequencies was calculated by a ${chi}$ ² test by using 2 x 2 and 3x 2 contingency tables.

RESULTS

Top

Results

For the HP assay, the three possible genotypes were identifiedas follows: (i) Allele C homozygous samples gave an earlierC_t with the C HP; (ii) allele G homozygous samples gave an earlierC_t with the G HP; (iii) heterozygous samples gave similar C_tsin both reactions. Figure 1 demonstrates that the HP assay allowsa clear discrimination of the three different genotypes, usinghuman DNA samples.

View larger version (12K):
[in this window]
[in a new window]
FIG. 1. HP assay for detection of the –44 DEFB1 SNP. Real-time PCR results using chromosomal DNA extracted from blood from two homozygous (C/C and G/G) patients and a heterozygous (C/G) patient. Amplifications using the C-allele HP are represented by closed triangles ( ${blacktriangleup}$ ), and the G-allele HP is represented by open circles ( ${circ}$ ).

Samples were analyzed in sets of up to 44 in 96-well plates,together with the three artificial templates and a no-templatenegative control, in less than 2 h. The HP assay was able toidentify C/C, C/G, and G/G genotypes with average ${Delta}$ C_ts of 11.6,0.3, and 7.7, respectively. Results are summarized in Table1.

View this table:
[in this window]
[in a new window]
TABLE 1. Average C_ts for the two different HPs for the three genotypes on human genomic DNA^a

Genotypes were confirmed by direct PCR sequencing of the regioncontaining the C $->$ G transversion at position –44 of theDEFB1 gene. Five samples for each genotype were selected forthis purpose. Sequencing data agrees with the HP assay in allcases (data not shown).

Genotype and allele frequencies for the four populations studiedare shown in Table 2. All the cohorts agree with the Hardy-Weinberglaw, further confirming the reliability of the assay. No significantdifferences were observed in the allele or genotype frequenciesat position –44 of the DEFB1 gene among patients sufferingfrom EOP versus healthy controls in the two ethnic populationsstudied. The C-allele frequency for the Caucasian (23%) andAfrican American (5%) healthy controls agrees with previouslyreported data by Jurevic et al. (13).

View this table:
[in this window]
[in a new window]
TABLE 2. Allele and genotype frequencies in the populations studied

DISCUSSION

Top

Discussion

We have developed a useful assay for medium-scale associationstudies of human populations based on an ARMS principle. TheHP assay uses unlabeled hairpin-shaped primers, designed followingthe conditions and the parameters recommended for the designof molecular beacons (26). Kaboev et al. (14) reported thatHPs increase the specificity and the sensitivity of PCRs bystrongly diminishing the formation of primer dimers and nonspecificproducts. The superiority of these primers over conventionallinear primers for SNP detection has previously been demonstrated(10). However, this is the first report describing the use ofHPs to increase the specificity of an ARMS assay for human DNAsamples.

The HP assay was designed using the conditions recommended byHazbón and Alland (10) and required no further modifications,illustrating the robustness of the technique. A secondary mutationwas introduced in the HPs to avoid an undesired secondary structure.Secondary mutations have also been reported to improve the discriminatorypower of the assay (3, 10, 22, 29).

The use of the SYBR Green I chemistry for the detection of theamplicons in a real-time PCR instrument, instead of expensivefluorophore-labeled probes, decreases the cost of the assayto an estimated $0.27 per genotype. Recently, new techniquesbased on the analysis of the melting profile of the ampliconhave been developed for single-tube genotyping, using SYBR GreenI chemistry in a real-time instrument. However, most of themrequire post-PCR manipulation (17) (increasing the risk of crosscontamination) or a time-consuming data handling process (11).Germer and Higuchi (7) proposed a protocol for SNP frequencystudies, based on ARMS, followed by a melting profile of theamplicons, but it requires a demanding optimization process,which our technique does not.

Sequencing data confirmed the results obtained with our HP assay.Using a 96-well format, we were able to test the 264 samplesin only 6 PCR runs (each of which lasts 2 h). These resultsconfirm the potential of the HP assay for medium- to large-scaleassociation studies of complex human diseases.

We applied this technique to study whether there was an associationbetween the C $->$ G transversion at position –44 in the DEFB1gene and EOP. The results do not support a direct associationof this SNP with EOP. It is possible that other SNPs in theDEFB1 gene could be associated with EOP. However, there areno reported associations of other polymorphisms in the DEFB1gene with an increased risk of infection, with the exceptionof a nonsynonymous mutation, associated with chronic obstructivepulmonary disease, that has been reported only in a Japanesepopulation (19). It is also possible that human beta-defensin1 is not active against periodontal bacteria and does not playa role in this disease. Supporting this hypothesis, it has beendemonstrated that Treponema denticola is resistant to humanbeta-defensin 1 (2). Unfortunately, no data are available regardingthe biological activity of this peptide against Actinobacillusactinomycetemcomitans and Porphyromonas gingivalis, two keyoral pathogens implicated in periodontal disease.

In conclusion, we have designed and optimized a simple, reliableassay for examining SNP frequencies that provides several majoradvantages over traditional SNP-detecting techniques. We havesuccessfully applied this technique to examine, for the firsttime, the associations between the SNP at position –44in the DEFB1 gene and EOP.

ACKNOWLEDGMENTS

This work was supported in part by a grant from the NationalInstitute of Dental and Craniofacial Research, Health DisparitiesProgramme, number R1DE14997A, and in part by NIH grant AI46669.M. Boniotto is supported by a Department of Defense appropriation.J. Eskdale and G. Lennon are supported by the New Jersey DentalSchool.

FOOTNOTES

* Corresponding author. Mailing address: Department of Oral Biology, New Jersey Dental School, 185 South Orange Ave., Newark, NJ 07103. Phone: (973) 972-2971. Fax: (973) 972-2970. E-mail: gallaggr{at}umdnj.edu.

REFERENCES

Top