This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakkas, L. I.
Right arrow Articles by Platsoucas, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakkas, L. I.
Right arrow Articles by Platsoucas, C. D.

 Previous Article  |  Next Article 

Clinical and Diagnostic Laboratory Immunology, January 2004, p. 195-202, Vol. 11, No. 1
1071-412X/04/$08.00+0     DOI: 10.1128/CDLI.11.1.195-202.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Decreased Expression of the CD3{zeta} Chain in T Cells Infiltrating the Synovial Membrane of Patients with Osteoarthritis

Lazaros I. Sakkas,1,{dagger} George Koussidis,1,{dagger} Efthimios Avgerinos,1,{dagger} John Gaughan,2 and Chris D. Platsoucas1*

Department of Microbiology and Immunology,1 Department of Physiology (Biostatistics), Temple University School of Medicine, Philadelphia, Pennsylvania 191402

Received 24 April 2003/ Returned for modification 16 July 2003/ Accepted 2 October 2003


arrow
ABSTRACT
 
Osteoarthritis (OA) is a heterogeneous disease which rheumatologists consider to be noninflammatory. However, recent studies suggest that, at least in certain patients, OA is an inflammatory disease and that patients often exhibit inflammatory infiltrates in the synovial membranes (SMs) of macrophages and activated T cells expressing proinflammatory cytokines. We report here that the expression of CD3{zeta} is significantly decreased in T cells infiltrating the SMs of patients with OA. The CD3{zeta} chain is involved in the T-cell signal transduction cascade, which is initiated by the engagement of the T-cell antigen receptor and which culminates in T-cell activation. Double immunofluorescence of single-cell suspensions derived from the SMs from nine patients with OA revealed significantly increased proportions of CD3{varepsilon}-positive (CD3{varepsilon}+) cells compared with the proportions of CD3{zeta}-positive (CD3{zeta}+) T cells (means ± standard errors of the means, 80.48% ± 3.92% and 69.02% ± 6.51%, respectively; P = 0.0096), whereas there were no differences in the proportions of these cells in peripheral blood mononuclear cells (PBMCs) from healthy donors (94.73% ± 1.39% and 93.79% ± 1.08%, respectively; not significant). The CD3{zeta}+ cell/CD3{varepsilon}+ cell ratio was also significantly decreased for T cells from the SMs of patients with OA compared with that for T cells from the PBMCs of healthy donors (0.84 ± 0.17 and 0.99 ± 0.01, respectively; P = 0.0302). The proportions of CD3{varepsilon}+ CD3{zeta}+ cells were lower in the SMs of patients with OA than in the PBMCs of healthy donors (65.04% ± 6.7% and 90.81% ± 1.99%, respectively; P = 0.0047). Substantial proportions (about 15%) of CD3{varepsilon}+ CD3{zeta}-negative (CD3{zeta}-) and CD3{varepsilon}-negative (CD3{varepsilon}-) CD3{zeta}- cells were found in the SMs of patients with OA. Amplification of the CD3{zeta} and CD3{delta} transcripts from the SMs of patients with OA by reverse transcriptase PCR consistently exhibited stronger bands for CD3{delta} cDNA than for CD3{zeta} cDNA The CD3{zeta}/CD3{delta} transcript ratio in the SMs of patients with OA was significantly lower than that in PBMCs from healthy controls (P < 0.0001). These results were confirmed by competitive MIMIC PCR. Immunoreactivities for the CD3{zeta} protein were detected in the SMs of 10 of 19 patients with OA, and they were of various intensities, whereas SMs from all patients were CD3{varepsilon}+ (P = 0.0023). The decreased expression of the CD3{zeta} transcript and protein in T cells from the SMs of patients with OA relative to that of the CD3{varepsilon} transcript is suggestive of chronic T-cell stimulation and supports the concept of T-cell involvement in OA.


arrow
INTRODUCTION
 
Osteoarthritis (OA) is a heterogeneous disease (3). Rheumatologists generally consider OA to be a noninflammatory disease (3), although patients with OA often exhibit inflammatory infiltrates in the synovial membrane (SM) (16, 19, 26, 37, 48, 51, 60). These infiltrates mostly consist of T cells and macrophages (16, 19, 26, 37, 48, 51, 60). The infiltrating T cells, at least in advanced OA, have many of the features found in rheumatoid arthritis (RA), including the following: (i) they often exhibit a nodular pattern (51, 60); (ii) they express early, intermediate, and late cell surface activation antigens (51); (iii) they express a TH1 cytokine pattern (18, 51, 52, 60); and (iv) they contain substantial proportions of oligoclonal T cells [S. R. Scanzello, L. I. Sakkas, N. Johanson, and C. D. Platsoucas, Arthritis Rheum. 42(Suppl.):S257, 1999 (abstract); S. R. Scanzello, L. I. Sakkas, N. Johanson, and C. D. Platsoucas, Scand. J. Immunol. 54(Suppl. 1):59, 2001 (abstract)], suggesting an antigen-driven immune response. Antigen-driven activation of T cells is thought to be important in the pathogenesis of RA (15, 45, 50).

T cells recognize peptides bound to self major histocompatibility complex class I or class II through their alpha/beta ({alpha}ß) T-cell antigen receptor (TCR). In addition, other {alpha}ß TCR-positive (TCR+) T cells that recognize nonpeptide antigens have been identified (56, 72). The engagement of the TCR with antigen initiates a signal transduction cascade which culminates in T-cell activation. The CD3{zeta} chain plays a very important role in this pathway. Signal transduction involves a series of tyrosine phosphorylations and activation of protein tyrosine kinases (68). One of the earliest events upon TCR engagement with antigen is the phosphorylation of the CD3{zeta} chain, which leads to activation of the ZAP-70 protein tyrosine kinase (6, 68). ZAP-70 protein tyrosine kinase activates the phospholipase C{gamma}1, which in turn increases intracellular Ca2+ and activates protein kinase C (49, 68).

Defective signal transduction with diminished tyrosine phosphorylation of the CD3{zeta} chain was found in synovial fluid (SF) T cells from patients with RA, and this was associated with decreased CD3{zeta} chain protein expression (32). Decreased CD3{zeta} protein expression was also reported in peripheral blood T cells from patients with RA (31) and systemic lupus erythematosus (SLE) (27) and in tumor-infiltrating lymphocytes (TILs) from patients with renal (12), colorectal (36, 38), and ovarian [23; J. Pappas, A. D. Wolfson, C. W. Helm, D. P. Barton, A. D. Tsygankov, and C. D. Platsoucas, FASEB J. 10:A1472, 1996 (abstract); J. Pappas, A. D. Wolfson, W. Jung, C. W. Helm, A. D. Tsygankov, and C. D. Platsoucas, J. Allergy Clin. Immunol. 99:S447, 1997 (abstract)] carcinoma and Hodgkin's disease (47). In the study described in this report, we investigated CD3{zeta} chain expression in the SMs from patients with OA at the transcript and protein levels.


arrow
MATERIALS AND METHODS
 
Patients. Nineteen patients with OA (35) 9 females, 10 males; mean age, 57 years; age range, 36 to 70 years) (35) and nine patients with RA (7 females, 2 males; mean age, 64.8 years; age range, 51 to 74 years) were included in this study. Patients with OA had primary OA (17 patients) or secondary OA due to avascular necrosis (2 patients). All patients with OA were treated with nonsteroidal anti-inflammatory drugs, whereas patients with RA were treated with nonsteroidal anti-inflammatory drugs and intramuscular gold (three patients) or methotrexate (one patient). Nine healthy controls (two females, seven males; mean age, 33.9 years; age range, 25 to 49 years) were also included in the study. SM specimens were obtained at surgery during joint replacement. The use of these specimens has been approved by the Institutional Review Board of Temple University Hospital.

Preparation of single-cell suspensions from SMs. SM tissues were finely minced with scissors and digested at 37°C for 2 h in RPMI 1640 culture medium supplemented with 5% fetal calf serum, garamycin (10 µg/ml), collagenase I (1.5 mg/ml; Sigma), collagenase IV (0.25 mg/ml; Sigma), and DNase I (0.15 mg/ml; Sigma). The digests were sequentially passed through a 200-µm-pore-size sieve (Fisher Scientific) and a 70-µm-pore-size sieve (Becton Dickinson). Single-cell suspensions were collected by centrifugation on a Ficoll-Hypaque density cushion. Peripheral blood mononuclear cells (PBMCs) from healthy donors were used as a methodological control in this study and were prepared by centrifugation on a Ficoll-Hypaque density cushion. These cells were immediately used for immunofluorescence staining.

Antibodies. A phycoerythrin (PE)-conjugated anti-CD3{varepsilon} monoclonal antibody (MAb; mouse immunoglobulin G1 [IgG1]; clone UCHT1; PharMingen, San Diego, Calif.) and an anti-CD3{zeta} MAb (mouse IgGl; clone 2H2D9[Tia-2]; Coulter/Immunotech) were used for flow cytometry. The anti-CD3{varepsilon} MAb (clone UCHT1; Novocastra, Newcastle upon Tyne, United Kingdom) and anti-CD3{zeta} MAb (Coulter) were used for immunohistochemistry.

Immunofluorescence and flow cytometry. Cells (106/ml) were at first fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature for 10 min and permeabilized by incubation at room temperature for 7 min in 0.1% saponin-0.2% bovine serum albumin-PBS solution. Double labeling for CD3{varepsilon}-positive (CD3{varepsilon}+) and CD3{zeta}-positive (CD3{zeta}+) cells was carried out by standard protocols. Briefly, the cells were incubated with anti-CD3{zeta} MAb and then with fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG (indirect immunofluorescence). Next, the cells were incubated with PE-conjugated anti-CD3{varepsilon} MAb (direct immunofluorescence). The cells were incubated in a total volume of 100 µl on ice and were washed at 4°C in 0.1% saponin-0.2% bovine serum albumin-PBS. Negative controls included cells incubated alone without MAb or IgG antibodies and cells incubated with FITC-conjugated anti-mouse IgG alone (omission of primary antibodies). Fluorescence-activated cell sorter analysis, after gating for lymphocytes only, was carried out within 3 h of staining.

Immunohistochemistry. Six-micrometer-thick cryostat SM sections were air dried for 1 h and fixed in 4% paraformaldehyde in PBS for 30 min. Endogenous peroxidase activity was blocked by incubation with 0.3% H2O2 in ice-cold methanol, and the cells were permeabilized by incubation in 0.1% saponin-2% fetal calf serum-PBS. Then the sections were stained for CD3{zeta} by the avidin-biotin indirect immunoperoxidase method as described previously (51), with the exception that incubations and washings were carried out in 0.1% saponin-PBS. Staining for CD3{zeta} was carried out as described previously (48).

RT-PCR. SM tissue samples were homogenized in tissue grinders (Kontes), and total RNA was obtained by using RNAzol B (Tel-Test). First-strand cDNA was synthesized from 5 µg of RNA by using Superscript II reverse transcriptase (RT) and 0.5 µg of oligo(dT) as a primer (GibcoBRL) and was kept at -30°C until it was used. CD3{delta} and CD3{zeta} cDNAs were detected by 35-cycle PCR, with each cycle consisting of the following incubation steps: 94°C for 45 s, 61°C for 45 s, and 72°C for 90 s, with a final extension at 72°C for 7 min, as described previously (51). The primers (5' to 3') used for CD3{delta} amplification were CTGGACCTGGGAAAACGCATC (5' end) and GTACTGAGCATCATCTCGATC (3' end), and those used for CD3{zeta} amplification were ACAGAGCTTTGGCCTGCTGGATC (5' end) and TAGGTGTCCTTGGTGGCTGTACT (3' end) (Bio-Synthesis) (17). The primer sequences span at least one intron, so a PCR product of a larger size would be obtained if any contaminating DNA was present. In addition, ß-actin was also amplified as a control (51). After gel electrophoresis the PCR products were visualized under UV light, and the densities of the bands were measured by densitometry with Sigma gel software. In some experiments the PCR products were also quantitated by a competitive MIMIC PCR (53)

Quantitative PCR. CD3{zeta} and CD3{delta} transcripts from SM specimens from five patients with OA were quantitated by competitive MIMIC PCR, as described previously (38, 51, 53). Internal nonhomologous competitive fragments (MIMIC DNA) for each transcript were constructed according to the instructions of the supplier (Clontech, Palo Alto, Calif.). Serial PCR mixtures containing a constant amount of sample cDNA (50 ng of RNA equivalents) were spiked with decreasing concentrations of MIMIC DNA. The PCR products were separated by electrophoresis through an ethidium bromide-stained 1.6% agarose gel and quantitated by comparison of the intensities of the transcript and the MIMIC bands. When the intensities of the target DNA and the MIMIC DNA product bands were equal, the amount of target DNA was equimolar to the amount of MIMIC DNA prior to amplification.


arrow
RESULTS
 
Double immunofluorescence staining with an anti-CD3{zeta} MAb and an anti-CD3{varepsilon} MAb, followed by flow cytometry analysis of single-cell suspensions derived from the SMs from nine patients with OA, revealed significantly increased proportions of CD3{varepsilon}+ T cells compared with the proportions of CD3{zeta}+ T cells (means ± standard error of the means [SEMs], 80.48% ± 3.92% and 69.02% ± 6.51%, respectively; P = 0.0096) (Table 1). In contrast, there were no significant differences in the proportions of CD3{varepsilon}+ and CD3{zeta}+ T cells (means ± SEMs, 94.73% ± 1.39% and 93.79% ± 1.08%, respectively; not significant) present in PBMCs from healthy donors (Table 1). The proportions of CD3{varepsilon}+ and CD3{zeta}+ T cells in the SMs of patients with OA were significantly lower than those found in PBMCs from healthy donors (means ± SEMs for CD3{varepsilon}+ T cells, 80.48% ± 3.92% and 94.73% ± 1.39%, respectively; P = 0.0064; means ± SEMs for CD3{zeta}+ T cells, 69.02% ± 6.51% and 93.79% ± 1.08%, respectively; P = 0.0051) (Table 1). Significant differences were also found in the CD3{zeta}+ cell/CD3{varepsilon}+ cell ratio, which was decreased for T cells from the SMs of patients with OA compared to that for T cells from the PBMCs of healthy donors (means ± SEMs, 0.84 ± 0.06 and 0.99 ± 0.01; respectively, P = 0.0302) (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Proportions of CD3{varepsilon}+ and CD3{zeta}+ cells from the SMs of patients with OA and peripheral blood of healthy individuals (controls) analyzed by double immunofluorescence and flow cytometry

The proportions of CD3{varepsilon}+ CD3{zeta}-negative (CD3{zeta}-) cells were significantly higher in the SMs of patients with OA than in the PBMCs of healthy donors (means ± SEMs, 15.39% ± 3.27% and 3.92% ± 0.99%, respectively; P = 0.0079) (Table 2), suggesting the presence of a sizable population of CD3{varepsilon}+ CD3{zeta}- cells in the SMs of patients with OA. In contrast, the proportions of CD3{varepsilon}+ CD3{zeta}+ cells were significantly lower in the SMs of patients with OA than in the PBMCs of healthy donors (means ± SEMs, 65.04% ± 6.70% and 90.81% ± 1.99%, respectively; P = 0.0047) (Table 2). No significant differences in the proportions of CD3{varepsilon}- CD3{zeta}+ cells were found in the SMs of patients with OA and the PBMCs from healthy donors (means ± SEMs, 3.93% ± 0.87% and 2.98% ± 1.01%, respectively; P = 0.4849) (Table 2). Significant differences were observed in the proportions of CD3{varepsilon}- CD3{zeta}- cells found in the SMs of patients with OA and in PBMCs from healthy donors (means ± SEMs, 15.60% ± 3.58% and 2.29% ± 0.57%, respectively; P = 0.0058) (Table 2), also suggesting the presence of a sizable population of CD3{varepsilon}- CD3{zeta}- cells in the SMs of patients with OA. Comparison of the proportions of the CD3{varepsilon}+ CD3{zeta}- cells to those of the CD3{varepsilon}- CD3{zeta}+ cells in the SMs of patients with OA revealed significantly increased proportions of CD3{varepsilon}+ CD3{zeta}- cells (means ± SEMs, 15.39% ± 3.27% and 3.93% ± 0.87%, respectively; P = 0.0096) (Table 2). In contrast, there were no differences in the proportions of CD3{varepsilon}+ CD3{zeta}- cells and CD3{varepsilon}- CD3{zeta}+ cells in PBMCs from healthy donors (means ± SEMs, 3.92% ± 0.99% and 2.98% ± 1.01%, respectively; P = 0.3317) (Table 2). The results of representative experiments by double immunofluorescence and flow cytometry analysis of CD3{varepsilon}+ CD3{zeta}-, CD3{varepsilon}+ CD3{zeta}+, CD3{varepsilon}- CD3{zeta}+, and CD3{varepsilon}- CD3{zeta}- populations of mononuclear cells infiltrating the SMs of three patients with OA (patients 7, 3, and 4) are shown in Fig. 1. The results of representative experiments for the same cell populations from PBMCs from three healthy controls are also shown.


View this table:
[in this window]
[in a new window]
 
TABLE 2. CD3{varepsilon}+ CD3{zeta}-, CD3{varepsilon}+ CD3{zeta}+, CD3{varepsilon}- CD3{zeta}+, and CD3{varepsilon}- CD3{zeta}- cells from the SMs of patients with OA and peripheral blood of healthy individuals (controls) analyzed by double immunofluorescence and flow cytometry



View larger version (72K):
[in this window]
[in a new window]
 
FIG. 1. Results of representative experiments by double immunofluorescence and flow cytometry analysis of CD3{varepsilon}+ CD3{zeta}-, CD3{varepsilon}+ CD3{zeta}+, CD3{varepsilon}- CD3{zeta}+, and CD3{varepsilon}- CD3{zeta}- populations of mononuclear cells infiltrating the SMs of three patients with OA (patients 7, 3, and 4, from left to right, respectively) (OA-SM) and of peripheral blood mononuclear cells from three healthy controls (C-PB). The y axis shows CD3{varepsilon} staining, and the x axis shows CD3{zeta} staining. Immunofluorescence staining was carried out as described in Materials and Methods.

Amplification of the CD3{zeta} and CD3{delta} transcripts by RT-PCR showed invariably stronger bands for the CD3{delta} cDNA than for the CD3{zeta} cDNA. Representative results for 11 patients with OA are shown in Fig. 2. The CD3{zeta} /CD3{delta} transcript ratio in SMs from patients with OA (n = 11) was significantly lower than the CD3{zeta}/CD3{delta} transcript ratio in PBMCs from healthy controls (means ± SEMs, 0.063 ± 0.028 and 0.787 ± 0.023, respectively; P < 0.0001) (Fig. 3A). These results for five individuals were confirmed by semiquantitative competitive MIMIC PCR, as described previously (51) (data not shown). The CD3{zeta}/CD3{delta} transcript ratio in SMs from patients with RA (n = 9) was also significantly lower than the CD3{zeta}/CD3{delta} transcript ratio in peripheral blood from healthy controls (means ± SEMs, 0.327 ± 0.068 and 0.787 ± 0.023, respectively; P < 0.0001) (Fig. 3B).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. Amplification of reverse-transcribed cDNA of CD3{zeta} and CD3{delta} chains from the SMs of 11 patients with OA (lanes 1 to 11) and from the peripheral blood of a healthy donor (lane 12). Lane M, 100-bp ladder.



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 3. (A) CD3{zeta}/CD3{delta} transcript ratio in the SMs of patients with OA (OA SM) and peripheral blood (PB) from healthy controls (P < 0.0001). (B) CD3{zeta}/CD3{delta} transcript ratio in the SMs of patients with RA (RA SM) and peripheral blood from healthy controls (P < 0.0001).

The expression of CD3{zeta} and CD3{varepsilon} proteins was investigated by immunohistochemical staining of frozen sections of the SMs from 19 patients with OA and 11 patients with RA by using the anti-CD3{zeta} MAb or the anti-CD3{varepsilon} MAb, respectively, as described in Materials and Methods, and the ABC indirect immunoperoxidase method. Immunoreactivity for CD3{zeta} was detected in the SMs of 10 of 19 patients with OA and the SMs of 9 of 11 patients with RA. The intensity of the immunoreactivity for CD3{zeta}, when present, was variable. As anticipated, CD3{zeta} protein expression was not observed in those specimens that lacked expression of CD3{zeta} transcripts. However, certain specimens that expressed CD3{zeta} transcripts (often at low levels) did not express the CD3{zeta} protein, suggesting the involvement, among other mechanisms, of a transcriptional mechanism in the downregulation of CD3{zeta} protein expression. In contrast, immunoreactivity for CD3{varepsilon} was detected in all patients with OA and RA. These results are summarized in Table 3. The results of a representative immunostaining experiment are shown in Fig. 4.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Immunoreactivities of SMs from patients with OA or RA after staining with either anti-CD3{zeta} MAb or anti-CD3{varepsilon} MAb



View larger version (142K):
[in this window]
[in a new window]
 
FIG. 4. Immunoreactivities for CD3{zeta} (A) and CD3{varepsilon} (B) in the SMs of patients with OA. ABC immunoperoxidase staining was performed as described in Materials and Methods.


arrow
DISCUSSION
 
We report here that the expression of CD3{zeta} chain transcripts and protein in the SMs from patients with OA is decreased. Decreased expression of the CD3{zeta} chain in patients with OA may be of functional significance because the CD3{zeta} chain plays a significant role in antigen-specific T-cell activation (40, 62) This decreased expression of the CD3{zeta} chain is associated with anergy and T-cell hyporesponsiveness and may reflect chronic antigenic stimulation of T cells [12, 22, 23, 27, 31, 32, 36, 38, 43, 47, 61, 73; Pappas et al., FASEB J. 10:A1472, 1996 (abstract)]. Although such antigens have not been identified in patients with OA, evidence strongly suggesting that such an antigen-specific chronic T-cell activation may occur in patients with OA and that T cells may play an important role in the pathogenesis of the disease has been accumulating.

Mononuclear cell infiltrates consisting primarily of CD3+ T cells and monocytes (16, 19, 26, 37, 48, 51, 60) are often observed in the SMs of patients with OA (16, 19, 26, 37, 49). The T cells infiltrating the SMs of patients with OA often exhibit a nodular pattern (51, 60) and express certain early (CD69), intermediate (CD25), and late (CD45RO, HLA-DR) activation antigens. These infiltrating T cells are often angiocentric [L. I. Sakkas, C. R. Scanzello, C. D. Katsetos, N. A. Johanson, and C. D. Platsoucas, Rheumatology 39(Suppl.):117, 2000 (abstract)], and their presence is associated with the activation of vascular endothelial cells, as determined by the expression of E-selectin (5, 20, 63).

To determine whether a specific antigen-driven clonal immune response is taking place in the SMs of patients with OA, ß-chain T-cell receptor (TCR) transcripts were amplified from the SMs of patients with OA by the nonpalindromic adaptor PCR method or by Vß-specific PCR (54, 59). The amplified transcripts were cloned and sequenced. Sequence analysis revealed substantial proportions of identical copies of ß-chain TCR transcripts, suggesting the presence of oligoclonal expansions of T cells in the SMs from five of five patients with advanced OA [Scanzello et al., Arthritis Rheum. 42(Suppl.):S257, 1999 (abstract); Scanzello et al., Scand. J. Immunol. 54(Suppl. 1):59, 2001 (abstract)], strongly supporting a specific antigen-driven immune response(s) (C. Scanzello, L. I. Sakkas, B. Xu, C. N. Johanson, and C. D. Platsoucas, submitted for publication). The antigen(s) that elicits these T-cell responses is not known. However, an autoimmune response to chondrocyte SM components has been reported in patients with OA (2). Inflammation in patients with OA may not be restricted to the joints. Perivascular lymphocytic infiltrates have been reported in muscle biopsy specimens from 18% of the patients with OA examined (67).

Incidental infections with common herpesviruses may enrich the pool of activated T cells in the SMs of patients with OA. CD8+ T cells specific for Epstein-Barr virus (EBV) and cytomegalovirus are present at an increased frequency in the SF of patients with RA (57, 65) and certain patients with OA (57, 65) as well as in the affected organs of patients with various chronic inflammatory diseases (57). However, EBV gene expression is not altered in the SMs of patients with RA or OA, despite the presence of EBV antigen-specific T-cell clones (9). The viral peptide-specific CD8+ T cells comprised approximately 4% of the total CD8+ T cells in the SF of patients with RA (11) and were oligoclonal (11). However, the clonality of the remaining T cells that did not react with these viral epitopes was not examined in that study (11). In addition, the method used to determine the proportions of these viral peptide-specific CD8+ T cells, HLA class I peptide tetramer staining, provided estimates of CD8+ T-cell frequencies that were, on average, 4.4-fold higher than the frequencies obtained by enzyme-linked immunospot assays (64). These estimates were, in turn, on average 5.3-fold higher than the frequencies obtained by limiting dilution analysis (64). Although the viral peptide-specific CD8+ T cells that are present in the SMs of these patients may exhibit decreased expression of the CD3{zeta} antigen, their presence in relatively low proportions (see above) alone cannot account for the decreases in the proportions of CD3{zeta}+ cells found in the SMs of patients with OA in this study.

It appears that the recruitment of virus-specific CD8+ T cells in inflammatory joints of patients with OA is chemokine driven. T cells infiltrating the SMs of patients with OA are of the TH1 type (51) and express high levels of the chemokine receptor CCR5 on their surfaces (29). The ligand of CCR5, the chemokine macrophage inflammatory protein 1ß, is upregulated in the SF of patients with OA (21). In the SF of patients with RA, the vast majority of virus-specific CD8+ T cells express the chemokine receptor CCR5 (11).

It is also possible that in the SMs of these patients the virus-specific T cells recognize self-antigenic epitopes as being of viral origin by molecular mimicry. Molecular mimicry is defined as the presence of epitopes with substantial structural homology between host proteins and the proteins of microorganisms such as viruses, bacteria, and other organisms (13, 41, 42, 69). Therefore, a host immune response against a viral epitope may recognize as non-self a host epitope with substantial structural homology, even after the microorganism that elicited the immune response is not present. These molecular mimicry responses may lead to the development of autoimmune disease. Along these lines, it has been reported that T cells specific for an EBV antigen also respond to a self-peptide from a serine-threonine kinase (34). Intermolecular or intramolecular epitope spreading is another mechanism that can lead to the development of T-cell responses in the SMs of patients with OA (7, 24, 25, 58, 71). Epitope spreading is defined as the generation of de novo immune responses to new self-antigenic epitopes which are different and which do not share structural homology (cross-reactivity) to those that elicited the initial immune response. Epitope spreading is generated in the environment of chronic inflammation. Epitope spreading was first identified in autoimmune demyelinating diseases of the central nervous system (1, 24, 25, 42, 58, 71) and is now identified in antitumor immunity (10) and the immune response against organ grafts (7).

The SMs of patients with OA exhibit a TH1 cytokine profile (51, 52, 60). It could be argued that this TH1 response may be driven primarily by nonspecific functions of macrophages instead of T-cell responses to a specific antigen(s). Macrophages and synoviocytes produce interleukin-12 (52), a potent cytokine that drives the TH1 immune response by inducing the production of proinflammatory cytokines. Increased concentrations of macrophage inflammatory protein-1ß (MIP-1ß) have been reported in the SF of patients with OA (21). MIP-1ß is a ligand for the chemokine receptor CCR5, which is expressed on TH1 cells (29). In a recent review, Pelletier et al. (46) proposed that OA is an inflammatory disease and cited macrophages as the exclusive source of inflammation in the pathogenesis of OA, ignoring the role of T cells (46, 55). Although the mononuclear cell infiltration and the TH1 response may be explained by a nonspecific activation of T cells, such as cytokine-induced activation, our findings (see above) of T-cell oligoclonality in the SMs of five of five patients with advanced OA [Scanzello et al., Arthritis Rheum. 42(Suppl.):S257, 1999 (abstract); Scanzello et al., Scand. J. Immunol. 54(Suppl. 1):59, 2001 (abstract)] strongly suggest that T cells have undergone antigen-driven proliferation and clonal expansion in situ in the SMs of patients with OA in response to an as yet unidentified antigen(s). Although the nature and characteristics of the antigen(s) remain to be determined, it is clear that the view traditionally held by many rheumatologists and scientists alike that OA is a noninflammatory disease should be abandoned and that the disease should be reclassified.

In a manner similar to that for other conditions characterized by chronic T-cell activation (22), such as RA (31, 32), SLE (27), lepromatous leprosy (73), human immunodeficiency virus infection (66), renal carcinoma (12), colorectal carcinoma (36, 38), ovarian carcinoma [23; Pappas et al., FASEB J. 10:A1472, 1996 (abstract); Pappas et al., J. Allergy Clin. Immunol. 99:S447, 1997 (abstract)] and Hodgkin's disease (47), T cells from the SMs of patients with OA exhibit decreased expression of CD3{zeta} chain transcripts and protein. Although studies with T cells from the SMs of patients with OA have not been reported, this decreased expression of the CD3{zeta} chain in these other diseases is associated with anergy and T-cell hyporesponsiveness. In patients with RA, T cells from the peripheral blood and the SMs are functionally deficient or "frustrated," although these T cells express early, intermediate, and late activation antigens (19, 51). Additionally, these T cells from patients with RA exhibit decreased in vitro proliferation and impaired increases in intracellular Ca2+ levels after stimulation with mitogens and recall antigens (for a review, see reference 1). Similarly, in TILs [23, 28; Pappas et al., FASEB J. 10:A1472, 1996 (abstract)], peripheral blood T cells of patients infected with human immunodeficiency virus (66), and tumor-bearing mice (40), the decreased expression of CD3{zeta} was associated with reduced T-cell proliferative responses and decreased phosphorylation of the CD3{zeta} chain [23, 28; Pappas et al., FASEB J. 10:A1472, 1996 (abstract)]. Decreased CD3{zeta} chain expression in T cells from the SF of patients with RA was accompanied by decreased phosphorylation of the CD3{zeta} chain (32). Decreased phosphorylation of the CD3{zeta} chain was also observed in antigen-induced T-cell death (43) and in T cells that are in anergic state (30, 33).

The hyporesponsiveness of T cells in patients with RA could be also attributed to chronic exposure to tumor necrosis factor alpha (TNF-{alpha}), since it was reversed in vivo by anti-TNF-{alpha} antibody treatment (8). The effect of anti-TNF-{alpha} antibody treatment on CD3{zeta} chain expression was not investigated in that study (8). Apart from a chronic antigenic stimulation, other factors may also contribute to decreased CD3{zeta} chain expression. For example, activated macrophages can induce decreased CD3{zeta} chain expression in T cells by cell contact-dependent interaction (4) or oxidative stress (44).

The defect in CD3{zeta} chain expression appears to be reversible, and it was restored in TILs after stimulation with interleukin-2 [70; Pappas et al., J. Allergy Clin. Immunol. 99:S447, 1997 (abstract)]. Similarly, CD3{zeta} chain expression was restored in peripheral blood T lymphocytes in patients with Hodgkin's disease after stimulation with anti-CD3 and anti-CD28 MAbs (47). In patients with SLE, the loss of CD3{zeta} chain expression was found to be associated with an increased frequency of alternative splicing of the CD3{zeta} chain RNA (39). However, one study reported that the CD3{zeta} chain can serve as a substrate for caspase 3, and the decreased expression of the CD3{zeta} chain was associated with apoptosis of TILs (14). Furthermore, two populations of T cells, CD3{varepsilon}+ CD3{zeta}- cells and CD3{varepsilon}- CD3{zeta}- cells, were found to be present in substantial proportions (about 15%) in the SMs of patients with OA. These two populations of T cells are virtually absent from the peripheral blood of healthy donors. Their function is not known at present. Also, it is not known whether these populations can differentiate to CD3{varepsilon}+ CD3{zeta}+ T cells.

In conclusion, our finding of decreased expression of the CD3{zeta} chain by T lymphocytes from the SMs of patients with OA is suggestive of a chronic antigenic T-cell stimulation and reinforces the concept of T-cell involvement in OA.


arrow
ACKNOWLEDGMENTS
 
We thank Norman Johanson (formerly of the Department of Orthopedics, Temple University School of Medicine, and presently of the Department of Orthopedics, Hannemann University, Philadelphia, Pa.) for providing specimens for this study.

This work was supported in part by grant T32 AI07101 from the National Institutes of Health.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140. Phone: (215) 707-7929. Fax: (215) 707-7788. E-mail: chris.platsoucas{at}temple.edu. Back

{dagger} Present address: University of Thessaly, School of Medicine, Larisa 41222, Greece. Back


arrow
REFERENCES
 
    1
  1. Allen, M. E., S. P. Young, R. H. Michell, and P. A. Bacon. 1995. Altered T lymphocyte signaling in rheumatoid arthritis. Eur. J. Immunol. 25:1547-1554.[Medline]
  2. 2
  3. Alsalameh, S., J. Mollenhauer, N. Hain, K. P. Stock, J. R. Kalden, and G. R. Burmester. 1990. Cellular immune responses toward human articular chondrocytes. T cell reactivities against chondrocyte and fibroblast membranes in destructive joint diseases. Arthritis Rheum. 33:1477-1486.[Medline]
  4. 3
  5. Altman, R. D. 1991. Classification of disease: osteoarthritis. Semin. Arthritis Rheum. 20:40-47.[CrossRef][Medline]
  6. 4
  7. Aoe, I., Y. Okamoto, and I. Saito. 1995. Activated macrophages induce structural abnormalities of the T cell receptor-CD3 complex. J. Exp. Med. 181:1881-1886.[Abstract/Free Full Text]
  8. 5
  9. Carson, C. W., L. D. Beal, G. G. Hunder, C. M. Johnson, and W. Newman. 1994. Soluble E-selectin is increased in inflammatory synovial fluid. J. Rheumatol. 21:605-611.[Medline]
  10. 6
  11. Chan, A. C., M. Iwashima, C. W. Turck, and A. Weiss. 1992. ZAP-70: a 70 kd protein-tyrosine kinase that associates with T cell receptor {zeta} chain. Cell 71:649-662.[CrossRef][Medline]
  12. 7
  13. Ciubotariu, R., Z. Liu, A. I. Colovai, E. Ho, S. Itescu, S. Ravalli, M. A. Hardy, R. Cortesini, E. A. Rose, and N. Suciu-Foca. 1998. Persistent allopeptide reactivity and epitope spreading in chronic rejection of organ allografts. J. Clin. Investig. 101:398-405.[Medline]
  14. 8
  15. Cope, A. P., M. Londei, N. R. Chu, S. B. A. Cohen, M. J. Eliott, F. M. Brennan, R. N. Maini, and M. Feldmann. 1994. Chronic exposure to tumor necrosis factor (TNF) in vitro impairs the activation of T cells through the T cell receptor/CD3 complex; reversal in vivo by anti-TNF antibodies in patients with rheumatoid arthritis. J. Clin. Investig. 94:749-760.
  16. 9
  17. Edinger, J. W., M. Bonneville, E. Scotet, E. Houssaint, H. R. Schumacher, and D. N. Posnett. 1999. EBV gene expression not altered in rheumatoid synovia despite the presence of EBV antigen-specific T-cell clones. J. Immunol. 162:3694-3701.[Abstract/Free Full Text]
  18. 10
  19. el-Shami, K., B. Tirosh, E. Bar-Haim, L. Carmon, E. Vadai, M. Fridkin, M. Feldman, and L. Eisenbach. 1999. MHC class I-restricted epitope spreading in the context of tumor rejection following vaccination with a single immunodominant CTL epitope. Eur. J. Immunol. 29:3295-3301.[CrossRef][Medline]
  20. 11
  21. Fazou, C., H. Yang, A. J. McMichael, and M. F. C. Callan. 2001. Epitope specificity of clonally expanded populations of CD8+ T cells found within the joints of patients with inflammatory arthritis. Arthritis Rheum. 44:2038-2045.[CrossRef][Medline]
  22. 12
  23. Finke, J. H., A. H. Zea, J. Stanley, D. L. Longo, H. Mizoguchi, R. R. Tubbs, R. H. Wiltrout, J. J. O'Shea, S. Kudoh, E. Klein, R. M. Bukowski, and A. C. Ochoa. 1993. Loss of T-cell receptor {zeta} chain and p56lck in T-cells infiltrating human renal cell carcinoma. Cancer Res. 53:5613-5616.[Abstract/Free Full Text]
  24. 13
  25. Fujinami, R. S., and M. B. Oldstone. 1985. Amino acid homology between the encephalitogenic site of myelin basic protein and virus: mechanism for autoimmunity. Science 230:1043-1045.[Abstract/Free Full Text]
  26. 14
  27. Gastman, B. R., D. E. Johnson, I. L. Whiteside, and H. Rabinovich. 1999. Caspase-mediated degradation of T-cell receptor zeta chain. Cancer Res. 59:1422-1427.[Abstract/Free Full Text]
  28. 15
  29. Goronzy, J. J., and C. M. Weyand. 1995. T cells in rheumatoid arthritis: paradigms and facts. Rheum. Dis. Clin. N. Am. 21:655-674.[Medline]
  30. 16
  31. Haraoui, B., J. P. Pelletier, J. M. Cloutier, M. P. Faure, and J. Martel-Pelletier. 1991. Synovial membrane histology and immunopathology in rheumatoid arthritis and osteoarthritis. II. In vivo effects of antirheumatic drugs. Arthritis Rheum. 34:153-163.[Medline]
  32. 17
  33. Jensen, J. P., D. Hou, M. Ramsburg, A. Taylor, M. Dean, and A. M. Weissman. 1992. Organization of the human T cell receptor {zeta}/{eta} gene and its genetic linkage to the Fc7RII-FcRIII gene cluster. J. Immunol. 148:2563-2571.[Abstract]
  34. 18
  35. Kahle, P., J. G. Saal, K. Schaudt, J. Zacher, P. Fritz, and G. Pawelec. 1992. Determination of cytokines in synovial fluids: correlation with diagnosis and histomorphological characteristics of synovial tissue. Ann. Rheum. Dis. 51:731-734.[Abstract/Free Full Text]
  36. 19
  37. Kennedy, I. D., C. Plater-Zyberk, T. A. Partridge, D. F. Woodrow, and R. N. Maini. 1988. Morphometric comparison of synovium from patients with osteoarthritis and rheumatoid arthritis. J. Clin. Pathol. 41:847-852.[Abstract/Free Full Text]
  38. 20
  39. Koch, A. E., W. Turkiewicz, L. A. Harlow, and R. M. Pope. 1993. Soluble E-selectin in arthritis. Clin. Immunol. Immunopathol. 69:29-35.[CrossRef][Medline]
  40. 21
  41. Koch, A. E., S. L., M. R. Shah, R. Fu, D. D. Mazarakis, G. K. Haines, M. D. Burdick, R. M. Pope, and R. M. Strieter. 1995. Macrophage inflammatory protein-1b: a C-C chemokine in osteoarthritis. Clin. Immunol. Immunopathol. 77:307-314.[CrossRef][Medline]
  42. 22
  43. Krishnan, S., V. G. Warke, M. P. Nambiar, H. K. Wong, G. C. Tsokos, and D. L. Farber. 2001. Generation and biochemical analysis of human effector CD4 T cells: alterations in tyrosine phosphorylation and loss of CD3zeta expression. Blood 97:3851-3859.[Abstract/Free Full Text]
  44. 23
  45. Lai, P., H. Rabinowich, P. A. Crowley-Nowik, M. C. Bell, and G. Whiteside. 1996. Alterations in expression and function of signal transducing protein in tumor-associated T and NK cells in patients with ovarian carcinoma. Clin. Cancer Res. 2:161-173.[Abstract/Free Full Text]
  46. 24
  47. Lehmann, P. V., T. Forsthuber, A. Miller, and E. E. Sercarz. 1992. Spreading of T-cell autoimmunity to cryptic determinants of an autoantigen. Nature 358:155-157.[CrossRef][Medline]
  48. 25
  49. Lehmann, P. V., E. E. Sercarz, T. Forsthuber, C. M. Dayan, and G. Gammon. 1993. Determinant spreading and the dynamics of the autoimmune T-cell repertoire. Immunol. Today 14:203-208.[CrossRef][Medline]
  50. 26
  51. Linblad, S., and E. Hedfors. 1987. Arthroscopic and immunohistologic characterization of knee joint synovitis in osteoarthritis. Arthritis Rheum. 30:1081-1088.[Medline]
  52. 27
  53. Liossis, S. N., X. Z. Ding, G. J. Dennis, and G. C. Tsokos. 1998. Altered pattern of TCR/CD3-mediated protein tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. J. Clin. Investig. 101:1448-1457.[Medline]
  54. 28
  55. Lockhart, D. C., A. K. Chan, S. Mak, H. G. Jo, H. A. Daust, A. Carritte, C. C. Douville, P. S. Goedegebuure, and T. J. Eberlein. 2001. Loss of T-cell receptor-CD3zeta and T-cell function in tumor-infiltrating lymphocytes but not in tumor-associated lymphocytes in ovarian carcinoma. Surgery 129:749-756.[CrossRef][Medline]
  56. 29
  57. Loetscher, P., M. Uguccioni, L. Bordoli, M. Baggiolini, and B. Moser. 1998. CCR5 is characteristic of Th1 lymphocytes. Nature 391:344-345.[Medline]
  58. 30
  59. Madrenas, J., R. L. Wange, L. Wang, N. Isakov, E. Samelson, and R. N. Germain. 1995. Zeta phosphorylation without ZAP-70 activation induced by TCR antagonists or partial agonists. Science 267:515-518.[Abstract/Free Full Text]
  60. 31
  61. Matsuda, M., A. K. Ulfgren, R. Lenkei, M. Peterson, A. C. Ochoa, S. Lindblad, P. Andersson, L. Klareskog, and R. Kiessling. 1998. Decreased expression of signal-transducing CD3{zeta} chains in T cells from the joints and peripheral blood of rheumatoid arthritis patients. Scand. J. Immunol. 47:254-262.[CrossRef][Medline]
  62. 32
  63. Maurice, M. M., A. C. Lankester, A. C. Bezemer, M. F. Geersma, P. P. Iak, F. C. Breedveld, R. A. W. van Lier, and C. L. Verweij. 1997. Defective TCR-mediated signaling in synovial T cells in rheumatoid arthritis. J. Immunol. 159:2973-2978.[Abstract]
  64. 33
  65. Migita, K., K. Eguchi, Y. Kawabe, I. Isukada, Y. Ichinose, and S. Nagataki. 1995. Defective TCR-mediated signaling in anergic T cells. J. Immunol. 55:5083-5087.
  66. 34
  67. Misco L. S., S. M. Cross, R. Khanna, S. L. Elliot, C. Schmidt, S. J. Rye, and S. L. Silins. 1999. Crossreactive recognition of viral, self and bacterial peptide ligands by human class I-restricted cytotoxic T lymphocyte clonotypes: implications for molecular mimicry in autoimmune diseases. Proc. Natl. Acad. Sci. USA 96:2279-2284.[Abstract/Free Full Text]
  68. 35
  69. Moskowitz, R. W. 1993. Clinical and laboratory findings in osteoarthritis, p. 1735-1760. In D. J. McCarty and W. J. Koopman (ed.), Arthritis and allied conditions. Lea & Lebiger, Philadelphia, Pa.
  70. 36
  71. Mulder, W. M. C., E. Bloemena, M. J. Stukart, J. A. Kummer, J. Wagstaff, and R. J. Scheper. 1997. T cell receptor-{zeta} and granzyme B expression in mononuclear cell infiltrates in normal colon mucosa and colon carcinoma. Gut 40:113-119.[Abstract/Free Full Text]
  72. 37
  73. Myers, S. L., K. D. Brandt, J. W. Ehlich, K. D. Shelbourne, D. A. Heck, et al. 1990. Synovial inflammation in patients with early osteoarthritis of the knee. J. Rheumatol. 17:1662-1669.[Medline]
  74. 38
  75. Nakagomi, H., M. Petersson, T. Magnusson, C. Juhlin, M. Matsuda, H. Mellstedt, J. L. Taupin, E. Vivier, P. Andersson, and R. Kiessling. 1993. Decreased expression of signal-transducing zeta chains in tumor-infiltrating T cells and NK cells of patients with colorectal carcinoma. Cancer Res. 53:5610-5612.[Abstract/Free Full Text]
  76. 39
  77. Nambiar, M. P., E. J. Enyedy, V. G. Warke, S. Krishnan, G. Dennis, H. K. Wong, G. M. Kammer, and G. C. Tsokos. 2001. T-cell signaling abnormalities in systemic lupus erythematosus are associated with increased mutations/polymorphisms and splice variants of T-cell receptor zeta chain messenger RNA. Arthritis Rheum. 44:1336-1350.[CrossRef][Medline]
  78. 40
  79. Ohno, H., J. J. Aoe, S. Iaki, D. Kitamura, Y. Ishida, K. Rajewski, and I. Saito. 1993. Developmental and functional impairment of T cells in mice lacking CD3{zeta} chains. EMBO J. 12:4357-4366.[Medline]
  80. 41
  81. Oleszak, E. L., S. Perlman, and J. L. Leibowitz. 1992. MHV S peplomer protein expressed by a recombinant vaccinia virus vector exhibits IgG Fc-receptor activity. Virology 186:122-132.[CrossRef][Medline]
  82. 42
  83. Oleszak, E. L., J.-H. R. Chang, H. Friedman, C. D. Katsetos, and C. D. Platsoucas. Theiler's virus-induced demyelinating disease: a model for multiple sclerosis. Clin. Microbiol. Rev., in press.
  84. 43
  85. Orchansky, P. L., and H. J. Ieh. 1994. Activation-induced cell death in proliferating T cells is associated with altered tyrosine phosphorylation of TCR/CD3 subunits. J. Immunol. 153:615-622.[Abstract]
  86. 44
  87. Otsuji, M., Y. Kimura, I. Aoe, Y. Okamoto, and I. Saito. 1996. Oxidative stress by tumor-derived macrophages suppresses the expression of CD3{zeta} chain of T-cell receptor complex and antigen specific T-cell responses. Proc. Natl. Acad. Sci. USA 93:13119-13124.[Abstract/Free Full Text]
  88. 45
  89. Panayi, G. S., V. M. Corrigall, and C. Pitzalis. 2001. Pathogenesis of rheumatoid arthritis: the role of T cells and other beasts. Rheum. Dis. Clin. N. Am. 27:317-334.[CrossRef][Medline]
  90. 46
  91. Pelletier, J. P., J. Martel-Pelletier, and S. B. Abramson. 2001. Osteoarthritis, an inflammatory disease. Potential implication for the selection of new therapeutic targets. Arthritis Rheum. 44:1237-1247.[CrossRef][Medline]
  92. 47
  93. Renner, C., S. Ohnesorge, G. Held, S. Bauer, W. Jung, J. P. Pfitzenmeier, and M. Pfreundeschuh. 1996. T cells from patients with Hodgkin's disease have a defective T-cell receptor zeta chain expression that is reversible by T-cell stimulation with CD3 and CD28. Blood 88:236-241.[Abstract/Free Full Text]
  94. 48
  95. Revell, P. A., V. Mayston, P. Lalor, and P. Mapp. 1988. The synovial membrane in osteoarthritis: a histological study including the characterization of the cellular infiltrate present in inflammatory osteoarthritis using monoclonal antibodies. Ann. Rheum. Dis. 47:300-307.[Abstract/Free Full Text]
  96. 49
  97. Rudd, C. E., O. Janssen, T. Y. Cai, A. J. da Silva, M. Raab, and K. V. S. Prasad. 1994. Two-step TCR {zeta} CD3-CD4 and CD28 signaling in T cells: SH2/SH3 domains, protein-tyrosine and lipid kinases. Immunol. Today 15:225-234.[CrossRef][Medline]
  98. 50
  99. Sakkas, L. I., P. F. Chen, and C. D. Platsoucas. 1994. T-cell receptors in rheumatoid arthritis. Immunol. Res. 5:117-314.
  100. 51
  101. Sakkas, L. I., C. Scanzello, N. Johanson, J. Burkholder, A. Mitra, P. Salgame, C. D. Katsetos, and C. D. Platsoucas. 1998. T cells and T-cell cytokine transcripts in the synovial membrane in patients with osteoarthritis. Clin. Diagn. Lab. Immunol. 5:430-437.[Abstract/Free Full Text]
  102. 52
  103. Sakkas, L. I., N. Johanson, C. Scanzello, and C. D. Platsoucas. 1998. Interleukin-12 is expressed by infiltrating macrophages and synovial lining cells in rheumatoid arthritis and osteoarthritis. Cell Immunol. 188:105-110.[CrossRef][Medline]
  104. 53
  105. Sakkas, L. I., C. Tourtellotte, S. Berney, A. R. Myers, and C. D. Platsoucas. 1999. Increased levels of alternatively spliced IL-4 (IL-452) transcripts in peripheral blood mononuclear cells from patients with systemic sclerosis. Clin. Diagn. Lab. Immunol. 6:660-664.[Abstract/Free Full Text]
  106. 54
  107. Sakkas, L. I., B. Xu, C. Artlett, S. Jimenez, and C. D. Platsoucas. 2002. Oligoclonal T-cell expansion in the skin of patients with systemic sclerosis. J. Immunol. 168:3649-3659.[Abstract/Free Full Text]
  108. 55
  109. Sakkas, L. I., and C. D. Platsoucas. 2002. T cells may participate in the pathogenesis of osteoarthritis. Arthritis Rheum. 46:3112-3113.[CrossRef][Medline]
  110. 56
  111. Sallusto, F., R. Poupot, M. Clergue, R. DePalma, and J. J. Fournie. 2000. A flavonoid sulfate antigen activates human alphabeta CD8± Th2 lymphocytes in pollen allergy. Eur. J. Immunol. 30:964-968.[CrossRef][Medline]
  112. 57
  113. Scotet E., M.-A. Peyrat, X. Saulkin, C. Retiere, C. Coudel, F. Davodeau, et al. 1999. Frequent enrichement for CD8 T cells reactive against common herpes viruses in chronic inflammatory lesions: towards a reassessment of the pathophysiological significance of T cell clonal expansions found in autoimmune inflammatory processes. Eur. J. Immunol. 29:973-985.[CrossRef][Medline]
  114. 58
  115. Sercarz, E. E., P. V. Lehmann, A. Ametani, G. Benichou, A. Miller, and K. Moudgil. 1993. Dominance and crypticity of T cell antigenic determinants. Annu. Rev. Immunol. 11:729-766.[CrossRef][Medline]
  116. 59
  117. Slachta, C. A., V. Jeevanandam, B. Goldman, W. L. Lin, and C. D. Platsoucas. 2000. Coronary arteries from human cardiac allografts with chronic rejection contain oligoclonal populations of T cells. Persistence of identical clonally expanded ß-chain T-cell receptor transcripts from the early posttransplantation period (endomyocardial biopsies) to chronic rejection (coronary arteries). J. Immunol. 165:369-384.
  118. 60
  119. Smith, M. D., S. Triantafillou, A. Parker, P. P. Youssef, and M. Colman. 1997. Synovial membrane inflammation and cytokine production in patients with early osteoarthritis. J. Rheumatol. 24:365-371.[Medline]
  120. 61
  121. Stevanova, I., M. W. Saville, C. Peters, F. R. Cleghorn, D. Schwartz, D. J. Venzon, K. J. Weinhold, N. Jack, C. Bartholomew, W. A. Blattner, R. Yarchoan, and J. B. Bolen. 1996. HIV-infection-induced post-translational modification of T cell signaling molecules associated with disease progression. J. Clin. Investig. 98:1290-1297.[Medline]
  122. 62
  123. Sussman, J. J., J. S. Bonifacino, J. Lippincott-Schwartz, A. J. M. Weissman, I. Saito, R. D. Klausner, and J. D. Ashwell. 1988. Failure to synthesize the T cell CD3{zeta} chain: structure and function of a partial T cell receptor complex. Cell 52:85-95.[CrossRef][Medline]
  124. 63
  125. Tak, P. P., E. W. Thurkow, M. R., Daha, P. M. Kluin, T. J. Smeets, A. E. Meinders, and F. C. Breedveld. 1995. Expression of adhesion molecules in early synovial tissue. Clin. Immunol. Immunopathol. 77:236-242.[CrossRef][Medline]
  126. 64
  127. Tan, L. C., N. Gudgeon, N. E. Annels, P. Hansasuta, C. A. O'Callaghan, S. Rowland-Jones, A. J. McMichael, A. B. Rickinson, and M. F. Callan. 1999. A re-evaluation of the frequency of CD8+ T cells specific for EBV in healthy virus carriers. J. Immunol. 162:1827-1835.[Abstract/Free Full Text]
  128. 65
  129. Tan, L. C., A. G. Mowat, C. Fazou, T. Rostron, H. Roskell, P. R. Dunbar, C. Tournay, F. Romagne, M. A. Peyrat, E. Houssaint, M. Bonneville, A. B. Rickinson, A. J. McMichael, and M. F. Callan. 2000. Specificity of T cells in synovial fluid: high frequency of CD8+ T cells that are specific for certain viral epitopes. Arthritis Res. 2:154-164.[CrossRef][Medline]
  130. 66
  131. Trimble, L. A., and J. Lieberman. 1998. Circulating CD8 T lymphocytes in human immunodeficiency virus-infected individuals have impaired function and down modulate CD3 zeta, the signaling chain of the T-cell receptor complex. Blood 91:585-594.[Abstract/Free Full Text]
  132. 67
  133. Voskuyl, A. E., S. G. van Duinen, A. H. Zwnderman, F. C. Breedveld, and J. M. Hazes. 1998. The diagnostic value of perivacsular infiltrates in muscle biopsy specimens for the assessment of rheumatoid vasculitis. Ann. Rheum. Dis. 57:114-117.[Abstract/Free Full Text]
  134. 68
  135. Weiss, A. 1993. T cell antigen receptor signal transduction: a tale of tails and cytoplasmic protein tyrosine kinases. Cell 73:209-212.[CrossRef][Medline]
  136. 69
  137. Wucherpfennig, K. W., and J. L. Strominger. 1995. Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clones specific for myelin basic protein. Cell 80:695-705.[CrossRef][Medline]
  138. 70
  139. Yoong, K. F., and D. H. Adams. 1998. Interleukin-2 restores CD3 zeta chain expression but fails to generate tumor-specific lytic activity in tumor-infiltrating lymphocytes derived from human colorectal hepatic metastases. Br. J. Cancer 77:1072-1081.[Medline]
  140. 71
  141. Yu, M., R. P. Kinkel, B. Weinstock-Guttman, D. J. Cook, and V. K. Tuohy. 1998. HLA-DP: a class II restriction molecule involved in epitope spreading during the development of multiple sclerosis. Hum. Immunol. 59:15-24.[CrossRef][Medline]
  142. 72
  143. Zanni, M. P., S. von Greyerz, Y. Han, B. Schnyder, and W. J. Pichler. 1999. Recognition of local anesthetics by alphabeta+ T cells. J. Investig. Dermatol. 112:197-204.[CrossRef][Medline]
  144. 73
  145. Zea, A. H., M. I. Ochoa, P. Ghosh, D. L. Longo, W. G. Alvord, L. Valderrama, R. Falabella, L. K. Harvey, N. Saravia, L. H. Moreno, and A. C. Ochoa. 1998. Changes in expression of signal transduction proteins in T lymphocytes of patients with leprosy. Infect. Immun. 66:499-504.[Abstract/Free Full Text]


Clinical and Diagnostic Laboratory Immunology, January 2004, p. 195-202, Vol. 11, No. 1
1071-412X/04/$08.00+0     DOI: 10.1128/CDLI.11.1.195-202.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakkas, L. I.
Right arrow Articles by Platsoucas, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakkas, L. I.
Right arrow Articles by Platsoucas, C. D.